Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

- - - - -

A Puzzle for Molecular Biologists


  • Please log in to reply
8 replies to this topic

#1 antibodymania

antibodymania

    member

  • Active Members
  • Pip
  • 27 posts
9
Neutral

Posted 25 January 2011 - 01:38 PM

The Central Dogma of Molecular Biology...and how to have fun with it. Help Josh decode the password to John's computer by using molecular biology techniques. This puzzle is sure to exercise your mind...in a geeky sort of way.

How much do you know about Central Dogma of Molecular Biology: a Puzzle to exercise your mind

#2 Adrian K

Adrian K

    Legendary Graduate Beggar

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 684 posts
24
Excellent

Posted 26 January 2011 - 10:50 PM

ATGTACATGATCGACGACCTAGAGAATGCTATGGAA

Translated:
MYMIDDLENAME

Answer:
Smith
Expecting the world to treat you fairly because you are a good person is like expecting the lion not to attack you because you are a vegetarian.

..."best of our knowledge, as far as we know this had never been reported before, though I can't possible read all the published journals on earth, but by perform thorough search in google, the keywords did not match any documents"...

"what doesn't kill you, makes you stronger"---Goddess Casandra reminds me to be strong

"It's all just DNA.  Do it."---phage434

#3 Ameya P

Ameya P

    Rervm Cognoscere Cavsas

  • Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 269 posts
13
Good

Posted 27 January 2011 - 02:00 AM

Adrian,

Your posting of the answer deters people from even clicking on the link above.

Its like having results without even reading the hypothesis....
NEW!!!! Does lack of plants mean End of Photosynthesis on Earth on CoffeeTableScience!!!!

Image copyright: Adrian Koh SF.
Replication of this art is strictly prohibited without express permission of the artist

#4 Adrian K

Adrian K

    Legendary Graduate Beggar

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 684 posts
24
Excellent

Posted 30 January 2011 - 03:14 AM

Ops, my bad... sorry... I shall removed it...

p/s: how come I can't edit the post?

Edited by adrian kohsf, 30 January 2011 - 03:16 AM.

Expecting the world to treat you fairly because you are a good person is like expecting the lion not to attack you because you are a vegetarian.

..."best of our knowledge, as far as we know this had never been reported before, though I can't possible read all the published journals on earth, but by perform thorough search in google, the keywords did not match any documents"...

"what doesn't kill you, makes you stronger"---Goddess Casandra reminds me to be strong

"It's all just DNA.  Do it."---phage434

#5 casandra

casandra

    carpe diem by the jugulum

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 5,007 posts
51
Excellent

Posted 30 January 2011 - 05:18 AM

View Postadrian kohsf, on 30 January 2011 - 03:14 AM, said:

Ops, my bad... sorry... I shall removed it...

p/s: how come I can't edit the post?
because there's a time limit for editing and deleting a post, I think...perhaps 1 to 2 days post-posting (or we can try to find out here with this post)...:) and probably only the great panda, the admin and the mods can do something to it afterwards....

Edited by casandra, 30 January 2011 - 05:26 AM.

"Oh what a beauteousness!"
        - hobglobin, personal comment about my beauteous photo......

#6 antibodymania

antibodymania

    member

  • Active Members
  • Pip
  • 27 posts
9
Neutral

Posted 15 February 2011 - 11:05 AM

woohoo! congrats to Adrian for getting the answer!

#7 Adrian K

Adrian K

    Legendary Graduate Beggar

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 684 posts
24
Excellent

Posted 15 February 2011 - 09:57 PM

LOLx... got price for me?
^_^
Expecting the world to treat you fairly because you are a good person is like expecting the lion not to attack you because you are a vegetarian.

..."best of our knowledge, as far as we know this had never been reported before, though I can't possible read all the published journals on earth, but by perform thorough search in google, the keywords did not match any documents"...

"what doesn't kill you, makes you stronger"---Goddess Casandra reminds me to be strong

"It's all just DNA.  Do it."---phage434

#8 antibodymania

antibodymania

    member

  • Active Members
  • Pip
  • 27 posts
9
Neutral

Posted 16 February 2011 - 02:09 PM

View Postadrian kohsf, on 15 February 2011 - 09:57 PM, said:

LOLx... got price for me?
^_^

Hmm...well you can get free stuff (including gift cards and other fun science-y stuff) from the site by submitting antibody reviews! ;)

#9 Adrian K

Adrian K

    Legendary Graduate Beggar

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 684 posts
24
Excellent

Posted 16 February 2011 - 02:52 PM

View Postantibodymania, on 16 February 2011 - 02:09 PM, said:

View Postadrian kohsf, on 15 February 2011 - 09:57 PM, said:

LOLx... got price for me?
^_^

Hmm...well you can get free stuff (including gift cards and other fun science-y stuff) from the site by submitting antibody reviews! ;)

Hmn... too bad. My work doesn't involve using any antibody.. I'm a total immunology handicapped/ignorant.
Expecting the world to treat you fairly because you are a good person is like expecting the lion not to attack you because you are a vegetarian.

..."best of our knowledge, as far as we know this had never been reported before, though I can't possible read all the published journals on earth, but by perform thorough search in google, the keywords did not match any documents"...

"what doesn't kill you, makes you stronger"---Goddess Casandra reminds me to be strong

"It's all just DNA.  Do it."---phage434




Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.