I amplified a partial cDNA fragment (i'll call it X) using a gene-specific primer + oligo dT from 1st strand cDNA.
Afterward, i did another pcr with other primers using 1st strand cDNA to generate fragment which contains X. I found that there is an insertion of a few bases (black) in the middle of X (red), which contains stop codon:
cacggaattgcataggtaaattctgtcgaaaaatgtattctcgtttttatttcgtttgatttaatttttggtttattacagcattcagaatg
I suspect that the insertion is intron because my RNA was extracted using hot phenol method without treatment with DNase and since the X was obtained from 1st strand cDNA (it contains poly-A tail). However, from what i've read, most eukaryote intron follows GT-AG rule, but in this case its gg-ca.
I am trying to extract gDNA and conduct pcr to check whether it is really an intron due to DNA contamination.
What else must i do? Would this affect my thesis because my original intention was to obtain the cDNA sequence (i am trying to get a few cDNA sequences and 2 of my samples had this kind of insertion)?
0
No replies to this topic
