Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Sense and antisense DNA, and primer design


  • Please log in to reply
6 replies to this topic

#1 Nephrite

Nephrite

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 75 posts
3
Neutral

Posted 14 January 2011 - 01:32 AM

Hellow, everybody.

I`m trying to understand the philosophy of primer-design for RT-PCR. Here I read some very useful posts (many thanks!), but still have few general questions:


1. template DNA means the antisense, non-coding strand, which is complementary to the sense mRNA transcript that is translated into protein;

2. non-template DNA means the sense, coding strand, which does not code RNA but is like mirror image of the mRNA transcript. And this is the published sequence in the databases. It gives antisense RNA transcript, which is not translated into protein;

3. if this is correct, complementary to the sense DNA will be the reverse, downstream, or anti-sense primer;

4. in parallel, complementary to the anti-sense DNA will be the forward, upstream, or sense primer.

Is that correct?

Thank you.

Edited by Nephrit, 14 January 2011 - 02:24 AM.


#2 bob1

bob1

    Thelymitra pulchella

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 5,831 posts
415
Excellent

Posted 15 January 2011 - 06:23 PM

1) actually the template strand is equivalent to the sense (coding) strand on the DNA... which is then turned into RNA... from which you then make cDNA
Like this:

DNA: ATGATGATG
 RNA: UACUACUAC
cDNA: ATGATGATG
2)See above... it is the coding strand you are talking about!
3)The forward primer is the same as the 5'-3' sequence of the cDNA.
4) reverse primer is the reverse complement of the cDNA!

i.e. you have it all completely around the wrong way.

#3 Nephrite

Nephrite

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 75 posts
3
Neutral

Posted 16 January 2011 - 01:44 PM

1) actually the template strand is equivalent to the sense (coding) strand on the DNA... which is then turned into RNA... from which you then make cDNA
Like this:

DNA: ATGATGATG
 RNA: UACUACUAC
cDNA: ATGATGATG
2)See above... it is the coding strand you are talking about!
3)The forward primer is the same as the 5'-3' sequence of the cDNA.
4) reverse primer is the reverse complement of the cDNA!

i.e. you have it all completely around the wrong way.



Thank you, Bob1!

#4 wilson_trace

wilson_trace

    member

  • Active Members
  • Pip
  • 14 posts
0
Neutral

Posted 05 March 2011 - 01:46 AM

Hi,
In context to PCR primer design, the template DNA is the region of interest where you would like to design primers. It may be a sense strand or an antisense strand.

However, many a times, in case of expression studies, researchers take the coding strand as a template sequence.

More about these concepts can be found here:
http://thunder.biosc...dex.php/Primers
I would like to mention an excellent tool for designing real time PCR primers: Beacon Designer. It is quite convenient to use and provides specific and efficient primers for real time PCR assays.
Visit: http://premierbiosof...cons/index.html

Cheers
Wilson :)

#5 The Walking Glitch

The Walking Glitch

    member

  • Members
  • Pip
  • 2 posts
0
Neutral

Posted 04 April 2011 - 08:31 PM

Based on the guidelines given in this thread, I've tried to construct sense and antisense primers, could someone please tell me if this is right or not, and if not how to do it right. Thanks in advance.

I have the following ORF:
5' ATGGCGATGATGATGACTGGCCGTGTGCTGCCGGTGTGTGCCCTCTGCGTGCTGTGCTGCGGTTTGTTGTCGGCCGATGCCGGGGATGATGATGTTTCTGGTGATCATGGAACTTTAGGCGGAAGTGGAGTTGGGGCTGATGGTAGACCTTCAGTCCCGGTTGGTAGTGATGTATCCACTGGAGGTACAAAAGATGAATGTTCTCTGGGAAGTGGAGGTGGCTCTCCGGTTTCTGCTTCTACTCCTTGCAAATCTTTACTTTCTGATGCGGAAAATCCGGGGGGTGAGGTTTTCAATGACAACAAGAAAGGATTATCCCGCGTTGAAGGGAACTCCAATGTTGAGCAGGATCCGCCACAGCCAGGGTCTCACGTTGTATCGACAGCCGAGGTGCTAGCACCAGGACAATCCAATTCTGAGGCGCAAGAGCAGTCGTCCGGTAAACTAAGAACAGAAGAGGGGCGTAATAACGGTGATGGCGGCACAACTGTGAAAGAAGAAGTGACTGGCGTGAAGAGTAGAGACACTGCTGACCTGTCCCCTAACGACAGCCGCCCGCCAAAAGCAGCACGACCAGTGACGGGGGAAGAGAAAGGCACAGAGAAACAGGCAGCATCAAAGGCGTCATTAACGCCAGAAGAGGAACGAGGGACATCTGCTGCGACGGATCAAAAAGTTGACTTACCGAAGGAGGAAGCCGCGTCCAGCGCAGGTGCCACAAAAAATCGATCACCTGTCGGTCAACAACAAACAGAAGCTTCATCTCCCTCTACGAGTGGAAGTACTTCGACTCTGACTCCGCAAAAGGAACCCGCTGAGGAGCTCCATTCCAACAATAACCAACCACCTGGTGACGCAGCACCGACAGAAGGAACGCAACATGAAACTCTTCCTGGCGACAAAACGCAAACAGAACCAGCAACTACAAACAACAAACCGATTGACGCAACTCCAACTGGCGACAGTGAGAGCAGCCCCACGGCTCCTCCCGCCGGAGAGTCAGACGCCGCCACAACCACAACCACGAACAATCATGATCCGCGTAGCCTCAACAACAATGGCAACAATACATTCACAGAAGAAGTGGATCAGAAGGAAGCAACAAGAAAACCCAAAAACGCACCAGAAAGCACTGACACTGCAGCAGCCAACAGTGAAGCATCCGCAACAGCCATAAACATCTCCACTAACACAACAAACAAAACAACCACCGGCGACAGCAGCACCGCGGTCTCCCACACCACCTCCCCTCTTTCGCTTCTTCTTGTTGTTGCGTGTGCGGCTGCGGTGGTGGCCGCGTGA 3'

(I know it's not code but without tags it just runs off the screen)

The forward primer is the same as the 5'-3' sequence of the cDNA

5 ATGGCGATGATGATGACTGGCCGTGTGCTGCCGGTGTGTGCCCTCTGCGTGCTGTGCTGCGGTTTGTTGTC... and so on

Is this (above) the sense primer?

reverse primer is the reverse complement of the cDNA!

5 TCACGCGGCCACCACCGCAGCCGCACACGCAACAACAAGAAGAAGCGAAAGAGGGGAGGTGGTGTGGGAGA... and so on

Is the above the antisense primer? Also, do I have the 5' and 3' right on both of them?

#6 bob1

bob1

    Thelymitra pulchella

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 5,831 posts
415
Excellent

Posted 05 April 2011 - 03:39 PM

Your primers are correct. The 5'-3' is fine, as is your use of sense and antisense. Usually the primer is only 15-30 bp in length though.

There are any number of programs that will take a sequence and design primers for you, or reverse complement the sequence you have so you can choose a primer. Primer3 is a commonly used web based one. There are also lots of freeware and sharewares out there. I use ApE (A plasmid editor).

#7 The Walking Glitch

The Walking Glitch

    member

  • Members
  • Pip
  • 2 posts
0
Neutral

Posted 06 April 2011 - 07:38 PM

Thank you, I appreciate it.




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.