Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

- - - - -

Mutagenesis PCR problem


  • Please log in to reply
5 replies to this topic

#1 ken1987

ken1987

    member

  • Members
  • Pip
  • 2 posts
0
Neutral

Posted 07 January 2011 - 09:00 AM

Hi all,

I am new to labwork and am currently undertaking a masters by research

I am trying to mutate a plasmid by mutagenesis PCR to introduce the AseI restriciton site

I am using the enzyme Pfu and primers of

o Forward Primer
GTCCAAACTCATTAATGTATCTTATG
55*C
o Reverse Primer
CATAAGATACATTAATGAGTTTGGAC
55*C

I use PCR times and temps of

Denature ------Denature------Annealing------Extension------Extension------Hold
95°C------------95°C--------------45°C---------------72°C---------------72°C------------4°C
2:00mins-------0:30mins-------0:30mins-------12:30mins-------5:00mins
.....................(-----------------x20 cycles--------------------).....................

Everytime I precipitate the DNA and then digest with enzymes there is no presence of DNA whatsoever whenn ran on a gel

Was just wondering if anyone had any opinions of what might be going wrong, or opinions on annealing temp, extension times or the design of my primers


Thanks

Edited by ken1987, 07 January 2011 - 09:05 AM.


#2 phage434

phage434

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,806 posts
130
Excellent

Posted 07 January 2011 - 02:27 PM

I would raise the annealing temperature to 55, and do 35 cycles instead of 20 cycles.   And I assume you didn't really mean for the times to be in minutes!!  Denaturing should be 30 seconds and annealing 30 seconds. I don't know how long your product is, but you should allow 1 minutes per Kb of expected product.  

You can run a gel immediately after the PCR, saving trouble, since the problem is clearly in the pcr reaction.  Until you get a good pcr product, it makes no sense to do digestions.

#3 ken1987

ken1987

    member

  • Members
  • Pip
  • 2 posts
0
Neutral

Posted 10 January 2011 - 03:08 AM

View Postphage434, on 07 January 2011 - 02:27 PM, said:

I would raise the annealing temperature to 55, and do 35 cycles instead of 20 cycles.   And I assume you didn't really mean for the times to be in minutes!!  Denaturing should be 30 seconds and annealing 30 seconds. I don't know how long your product is, but you should allow 1 minutes per Kb of expected product.  

You can run a gel immediately after the PCR, saving trouble, since the problem is clearly in the pcr reaction.  Until you get a good pcr product, it makes no sense to do digestions.

Thanks for your reply, yeah it was supposed to be 30secs, and 12mins 30secs for extension, as the Pfu I'm using suggests 2mins per kb and the plasmid is 6kbs

I shall try your suggestion, thank you

Also read somewhere that mutagenesis primers should have about 20 nucleotides flanking the site of mutation either side, are my primers to small? opinions anyone?

thanks

#4 ariaz

ariaz

    member

  • Active Members
  • Pip
  • 12 posts
0
Neutral

Posted 27 January 2011 - 04:49 AM

Hi,

I did mutagenesis using Stratagene site directed mutagenesis protocol.
Acording to that protocol, your primer should be 40-45 bp long and the site which you want to change should be in middle. Both primers would be complementary to each other and Tm should be more than 78 C. I did not use their kit, just follow the protocol.

http://kirschner.med...ckchangepdf.pdf

cheers

#5 bob1

bob1

    Thelymitra pulchella

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 4,350 posts
224
Excellent

Posted 27 January 2011 - 06:04 PM

Your primers are not well designed... you need to have a longer gene specific site (20ish bp) on each primer and have the restriction site with 3-6 bp on both sides of the site like this:

3-6RESITE3-6genespecificprimer

The annealing temperature is calculated off the specific part of the primer, do not worry about the RE site annealing temperature, that doesn't come into it until later and doesn't seem to affect how the PCR works.

As mentioned above if you are using Qickchange style, the primers should be complementary to each-other.  If you are just wanting to sub-clone the gene you shouldn't need to do full mutagenesis.

#6 wilson_trace

wilson_trace

    member

  • Active Members
  • Pip
  • 14 posts
0
Neutral

Posted 05 March 2011 - 01:39 AM

Hi,

As per my suggestion, to introduce a mutation you should attach a restriction enzyme to your designed primers and then amplify the plasmid and ligate it. The enzyme should be added at the 5' end of the primers.

Also, the primers should be between 25 and 45 bases in length, with a melting temperature of ≥78°C. The desired mutation should be in the middle of the primer with ~10–15 bases of correct sequence flanking both the sides. And both the mutagenic primers should anneal to the same sequence on opposite strands of the plasmid.

Here is a freeware to design specific mutagenic primers:
http://www.premierbi...esis/index.html

Cheers !! :rolleyes:

Wilson




Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.