9 replies to this topic

[hianghao]

I've got a sequence, ~1.5kb:
5' ATAGTCTAGTTCTGACCATCAGTATTCAAAGCTGCAACCATGTTGCTTTTCCTGCTGTTGTCGGTGGTCACGTTGACCTATTTCTGGATTGGAAGG
--------TGTTATGATAGCGAAGGTAGCATTGATTCTACTCTTGTCGAAGTACAACTTTAAGGCAACACAAGATTCAAAAATGGTGTTCAGTTCAGCGTCGGTGCCGCTTTTACCAAAACATGGAGTGTTACTGAAAATTTCCAAAAGAAAATAAAAGTATTTTTATTTCCGAAAAAAAAA 3'

I want to conduct a pcr to amplify this fragment and the product must include both the ATG and TAA. However, i was not able to design a suitable one using primer3plus... mostly due to the 3' end which contains high AT and dimers. The only possible pair that i've designed after checking with NetPrimer for dimer and blast for specificity, however, produce fragment of only ~750 bp. I've tried different Ta from 46-54C (Tm=55 and 56C). Ta
54C>> no band
52C>> no band
51C>> 1 smear 100
50C>> 1 distinct band ~750bp (2.5U polymerase); 3 bands for 1.25U: 750 (distinct), 100(smear), 1500 (faint)
49C>> 1 band 750, 1 smear 100
48C>> multiple faint bands
46C>> multiple faint bands
All rxn in 25 ul mixture, 1.25U polymerase
What should i do for this situation? I've spent 2 days to try to design another set of primers, but it seems impossible...

[bob1]

Have you tried secondary structure inhibitors such as DMSO and/or betaine?

[Ameya P]

hianghao, on 13 December 2010 - 05:55 AM, said:

50C>> 1 distinct band ~750bp (2.5U polymerase); 3 bands for 1.25U: 750 (distinct), 100(smear), 1500 (faint)

Here, you could try giving the polymerase more time for extension....so that the 1.5kb faint band gets better. you must try diff. concentrations of  Mg and like Bob said, something like betaine.

I think DMSO works better when you have GC rich DNA, but in your case you have AT rich DNA, so I would go for betaine.

[hianghao]

gt_ameya, on 13 December 2010 - 09:41 PM, said:

hianghao, on 13 December 2010 - 05:55 AM, said:

50C>> 1 distinct band ~750bp (2.5U polymerase); 3 bands for 1.25U: 750 (distinct), 100(smear), 1500 (faint)

Here, you could try giving the polymerase more time for extension....so that the 1.5kb faint band gets better. you must try diff. concentrations of  Mg and like Bob said, something like betaine.

I think DMSO works better when you have GC rich DNA, but in your case you have AT rich DNA, so I would go for betaine.

I'll try to find betaine. My extension time was 5m and final extension was 10m. Thanks for the advises!

[hianghao]

hianghao, on 14 December 2010 - 12:47 AM, said:

gt_ameya, on 13 December 2010 - 09:41 PM, said:

hianghao, on 13 December 2010 - 05:55 AM, said:

50C>> 1 distinct band ~750bp (2.5U polymerase); 3 bands for 1.25U: 750 (distinct), 100(smear), 1500 (faint)

Here, you could try giving the polymerase more time for extension....so that the 1.5kb faint band gets better. you must try diff. concentrations of  Mg and like Bob said, something like betaine.

I think DMSO works better when you have GC rich DNA, but in your case you have AT rich DNA, so I would go for betaine.

I'll try to find betaine. My extension time was 5m and final extension was 10m. Thanks for the advises!

I can't find any betaine in my lab, but probably DMSO in neighbour labs. How much DMSO should i use for a reaction? I searched in the archives and found threads discussing bout AT rich template pcr using extension of ~60-65C. I am not sure whether my template is AT rich. I can only say that the 3' end is AT rich. Should i try extension of 60C?

Edited by hianghao, 14 December 2010 - 06:14 AM.

[bob1]

I use 1 ul of DMSO per 20 ul reaction - works out to be about 6 M if I recall correctly.

I wouldn't bother with the lower extension temperature.  How similar are the calculated primer annealing temperatures?

[hianghao]

bob1, on 14 December 2010 - 04:55 PM, said:

I use 1 ul of DMSO per 20 ul reaction - works out to be about 6 M if I recall correctly.

I wouldn't bother with the lower extension temperature.  How similar are the calculated primer annealing temperatures?

I don't really get what u mean by calculated Ta. Tm of both primers were 55.3 and 54.3C. Polymerase = Pfu
95C  1m
95C  30s ---
50c  30s    | 35cycles
72C  5m  ---
72C  10m

[Ameya P]

hianghao, on 14 December 2010 - 07:02 PM, said:

95C  1m
95C  30s ---
50c  30s    | 35cycles
72C  5m  ---
72C  10m

Is there any particular reason that your annealing and denaturation times are so less as compared to extension time? I dont quite remember what role annealing time plays, but would suggest increasing both denaturation and annealing temperatures by atleast 15 secs.

[Ameya P]

hianghao, on 14 December 2010 - 07:02 PM, said:

I don't really get what u mean by calculated Ta. Tm of both primers were 55.3 and 54.3C. Polymerase = Pfu

Calculated Ta is your melting temp. minus five degrees. So ideally your Ta should be 49oC and since you are not getting any product there... you should go lower 45-48oC and make your extension stringent to get a single band of your interest

Edited by gt_ameya, 14 December 2010 - 11:53 PM.

[hianghao]

gt_ameya, on 14 December 2010 - 11:51 PM, said:

hianghao, on 14 December 2010 - 07:02 PM, said:

I don't really get what u mean by calculated Ta. Tm of both primers were 55.3 and 54.3C. Polymerase = Pfu

Calculated Ta is your melting temp. minus five degrees. So ideally your Ta should be 49oC and since you are not getting any product there... you should go lower 45-48oC and make your extension stringent to get a single band of your interest

There is no particular reason why my denaturation and annealing were low. Before dealing with this sample with this set of primers, i use another set of primers for another sample and it worked well. So i didn't bother with the setting. Besides that, because i read that Pfu require 2m ext time per kb, and my fragment is ~1.5kb, so i put it longer. I've tried lower Ta but got smear. The best Ta was 50C, but wrong size.

I've tried DMSO, the bands improved but still the size was 750bp not 1500bp

Edited by hianghao, 15 December 2010 - 07:50 PM.