Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

d2EGFP Primers for Genotyping


  • Please log in to reply
5 replies to this topic

#1 Tobias

Tobias

    member

  • Members
  • Pip
  • 3 posts
0
Neutral

Posted 02 December 2010 - 05:18 PM

Hi everybody,

I recently got mice expressing d2EGFP under control of various promoters. In order to genotype them, I was trying to get the sequence of d2EGFP or literature in which people have already used d2EGFP primers for genotyping. I found one paper (Man et al , 2007) that have done it and also provide primer sequences. However, these do not seem to work in my mice.

Thank you very much for your help!

All the best,

Tobias

#2 ivanbio

ivanbio

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 116 posts
7
Neutral

Posted 02 December 2010 - 06:22 PM

Hi Tobias,

From what you describe, it seems to me that maybe your primers are not specific to the d2EGFP insert you are using. If you post the sequences of the primers, and the d2EGFP insert/gene, maybe we can help you out in determining what is the problem here. In my experience EGFP primers that were designed for one EGFP do not necessarily work for another EGFP, in part because there are many EGFP versions and each has numerous mutations (which may not be compatible with various EGFP primer sets).

Cheers,

Ivan

Ivan
Carlsbad, CA

#3 Tobias

Tobias

    member

  • Members
  • Pip
  • 3 posts
0
Neutral

Posted 02 December 2010 - 09:43 PM

Dear Ivan,

thank you very much for your reply.
The main problem for me is that I dont have the sequence of the d2EGFP used on the mice. The primers that I used are below:


Forward: 5-cggcatcaaggtgaacttcaagatccg-3;

Reverse: 5-cttgtacagctcgtccatgccg-3

However using the primer sequence I was not able to get info on the sequence or the product they should amplify.
I am really stuck here...

Again, thank you very much for your help!

Tobias

#4 Rsm

Rsm

    Post Dog

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 374 posts
8
Neutral

Posted 02 December 2010 - 11:43 PM

d2EGFP has the sequence
ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGAAGCTTAGCCATGGCTTCCCGCCGGAGGTGGAGGAGCAGGATGATGGCACGCTGCCCATGTCTTGTGCCCAGGAGAGCGGGATGGACCGTCACCCTGCAGCCTGTGCTTCTGCTAGGATCAATGTGTAG
you can find the sequence at Clontech http://www.clontech....ors.asp?alpha=d
when you use the mentioned primers, you will get a PCR product of 238bp. They are however not specific for the MODC form of eGFP.

rsm
I got soul, but I'm not a soldier

#5 Tobias

Tobias

    member

  • Members
  • Pip
  • 3 posts
0
Neutral

Posted 07 December 2010 - 11:25 PM

Dear RSM,

Thank you very much for your reply. Using the sequence you provided, I was able to design new primers that work!
Problem solved, thank you very much!
Tobias


d2EGFP has the sequence
ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGAAGCTTAGCCATGGCTTCCCGCCGGAGGTGGAGGAGCAGGATGATGGCACGCTGCCCATGTCTTGTGCCCAGGAGAGCGGGATGGACCGTCACCCTGCAGCCTGTGCTTCTGCTAGGATCAATGTGTAG
you can find the sequence at Clontech http://www.clontech....ors.asp?alpha=d
when you use the mentioned primers, you will get a PCR product of 238bp. They are however not specific for the MODC form of eGFP.

rsm



#6 Rsm

Rsm

    Post Dog

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 374 posts
8
Neutral

Posted 08 December 2010 - 02:36 AM

You're welcome
:)
I got soul, but I'm not a soldier




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.