Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Suggestion needed-Deleting single neuclotide by QUICK CHANGE


  • Please log in to reply
5 replies to this topic

#1 PAUL@MD

PAUL@MD

    member

  • Members
  • Pip
  • 3 posts
0
Neutral

Posted 12 November 2010 - 09:46 AM

Hi All,

I need suggestion for deleting a single nucleotide which is not in frame by Quick change.
I made a clone with MBP_TEVPROTEASE_MYPEPTIDE.After sequenced the plasmid i found one single nucleotide
is there extra .Which makes the frame shift.If i delete that nucleotide everything will be alright.

Here is my sequence:

CCCTGAAAGACGCGCAGACTCCGGGTAGCCTGGAAGTTCTGTTCCAGGGGCCCATGG-AA Actual sequence
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
CCCTGAAAGACGCGCAGACTCCGGGTAGCCTGGAAGTTCTGTTCCAGGGGCCCATGGGAA my plasmid


Extra nucleotide indicated in RED COLOR.


My question is can i use "quick change mutageneis method" to delete a SINGLE nucleotide?
Had anyone tried Quick change kit to delete a single nucleotide?

#2 pDNA

pDNA

    Veteran

  • Awaiting Authorisation
  • PipPipPipPipPipPipPipPipPipPip
  • 494 posts
14
Good

Posted 12 November 2010 - 09:51 AM

this should be no problem!

but keep in mind that you have to completly get rid of the template you used for the pcr ...this is the most important the step. The PCR itselfe should be no problem!

Regards,
p

#3 Rsm

Rsm

    Post Dog

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 385 posts
9
Neutral

Posted 12 November 2010 - 09:52 AM

My question is can i use "quick change mutageneis method" to delete a SINGLE nucleotide?
Had anyone tried Quick change kit to delete a single nucleotide?


Sure, you can delete a single or multiple nucleotides, no problem. Can you provide us with some more nucleotides 5' of your deletion site? Let's say, 30 to each side?
I am a bit worried about your GGGGCCC there...

rsm

Edited by Rsm, 12 November 2010 - 09:53 AM.

I got soul, but I'm not a soldier

#4 PAUL@MD

PAUL@MD

    member

  • Members
  • Pip
  • 3 posts
0
Neutral

Posted 12 November 2010 - 12:21 PM

Thank you for your reply.

here is the sequence (not the full).But 30 bp from each side to the mutation point.

GGTATGCCGTGCGTACTGCGGTGATCAACGCCGCCAGCGGTCGTCAGACTGTCGATGAAG 1108
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GGTATGCCGTGCGTACTGCGGTGATCAACGCCGCCAGCGGTCGTCAGACTGTCGATGAAG 270

CCCTGAAAGACGCGCAGACTCCGGGTAGCCTGGAAGTTCTGTTCCAGGGGCCCATGG-AA 1167
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
CCCTGAAAGACGCGCAGACTCCGGGTAGCCTGGAAGTTCTGTTCCAGGGGCCCATGGGAA 210

AACTTATATTTCCAAGGCATCCACAAACAAAAAGAAAAATCACGCTTACAGGGCGGTGTT 1227
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AACTTATATTTCCAAGGCATCCACAAACAAAAAGAAAAATCACGCTTACAGGGCGGTGTT 150

CTTGTTAACGAAATCTTAAACCACATGAAACGCGCAACACAAATTCCATCCTATAAAAAA 1287
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
CTTGTTAACGAAATCTTAAACCACATGAAACGCGCAACACAAATTCCATCCTATAAAAAA 90

TTAATTATGTACTAATAAGGATCC 1311
||||||||||||||||||||||||
TTAATTATGTACTAATAAGGATCC 66

#5 Rsm

Rsm

    Post Dog

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 385 posts
9
Neutral

Posted 15 November 2010 - 12:35 AM

QuikChange Primer Design Program from Agilent suggests FORWARD gttccaggggcccatggaaaacttatatttccaag and REVERSE cttggaaatataagttttccatgggcccctggaac for your mutagenesis. So no problem, it seems.

rsm
I got soul, but I'm not a soldier

#6 PAUL@MD

PAUL@MD

    member

  • Members
  • Pip
  • 3 posts
0
Neutral

Posted 15 November 2010 - 08:59 AM

hI all

Thank you for your valuable suggestions.


Paul




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.