Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

- - - - -

Adding Restriction Site to DNA


  • Please log in to reply
3 replies to this topic

#1 VanderWall

VanderWall

    member

  • Active Members
  • Pip
  • 7 posts
0
Neutral

Posted 06 October 2010 - 07:58 PM

First off, I am new to both molecular biology and also to this site. I'm actually a business student with only some college biology under my belt. My question is regarding PCR and more specifically taking a piece of DNA and amplifying it, then digesting it using to added restriction sites.

The to enzymes I am interested in added are 5' BamHI

and PvuI 3'

My original DNA sequence is

AAG TCGCTTTATCGTACCCTGAACGGTTACGTACTAACACCTGGCAA

I ran my almost 50 base pair DNA through a cutter and came out with something looking like this:
Base Pairs

so as of now I have complimentary pairs, but I am really confused as to where my restriction sites go... I started doing to searching around and looking for different primers, or even using part of my code as a primer.
Can someone with some experience with DNA amplification point me in the right direction, I've been looking at this for a few hours now and have been making little progress, something tells me I am over complicating this.

#2 donny

donny

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 73 posts
3
Neutral

Posted 07 October 2010 - 07:49 AM

If you want to amplify your DNA, you need a pair of forward and reverse primers. To add restriction sites, your primers will be designed to contain your restriction sites, followed by a short stretch of your DNA sequence. For your case using BamHI (cleavage site GGATCC) and PvuI (CGATCG),

CTAGCGGGATCCATGGCTACGTGG                                                                                  
____________ATGGCTACGTGGCTGGGCATCCGAT...............................CGTACGTGGACTATTGA                    
____________TACCGATGCACCGACCCGTAGGCTA...............................GCATGCACCTGATAACA              
____________________________________________________________________GCATGCACCTGATAACACGATCGTGCATG


Top row is a possible forward primer design (5'->3'), second row is the sense DNA strand (for example)(5'->3'), third row is the anti-sense DNA strand (3'->5'), and last row is a possible reverse primer design (3'->5'). The forward primer has BamHI site (underlined) followed by a short stretch of the DNA of interest (sense). The reverse primer has PvuI site and a short stretch of the DNA of interest (anti-sense). The PCR product will then have both restriction sites in it. You can then digest the DNA fragment with the restriction enzymes. The extra (random) bases before the restriction sites are for efficient digestion because some restriction enzymes cannot digest DNA too near to the ends.

Is this a tutorial question or a practical application? I'm not sure if the DNA sequence you provided is the sequence you want to amplify 'cos for such a short sequence, you might as well synthesise the DNA fragment with the restriction sites included instead of PCR. If this is a tutorial question, replace the DNA sequence in the example here with your sequence to get your answer, provided I understood your question correctly.

#3 VanderWall

VanderWall

    member

  • Active Members
  • Pip
  • 7 posts
0
Neutral

Posted 07 October 2010 - 01:10 PM

I think I followed the general idea of what you tried to do, and to answer your question, this isn't a synthized strand I am using, it's simply a tutorial problem. With that said I took a look at what you did and using my original strand from above I now have something that came out looking like this:

DNA Strand:
AAGTCGCTTTATCGTACCCTGAACGGTTACGTACTAACACCTGGCAA

CTAGCGGGATCCAAGTCGCTTT                                                                                  
____________AAGTCGCTTTATCGTACCCTGAACGGTTACGTACTAACACCTGGCAA                    
____________TTCAGCGAAATAGCATGGGACTTGCCAATGCATGATTGTGGACCGTT              
___________________________________________________________CGATCGTGCATG


Making the final sequence after digestion with the two added restriction enzymes:

CTAGCGGGATCCAAGTCGCTTTATCGTACCCTGAACGGTTACGTACTAACACCTGGCAAGCTAGCACGTAC
GATCGCCCTAGGTTCAGCGAAATAGCATGGGACTTGCCAATGCATGATTGTGGACCGTTCGATCGTGCATG


Does this look like it would work now, or am I still misunderstanding the setup?

View Postdonny, on 07 October 2010 - 07:49 AM, said:

If you want to amplify your DNA, you need a pair of forward and reverse primers. To add restriction sites, your primers will be designed to contain your restriction sites, followed by a short stretch of your DNA sequence. For your case using BamHI (cleavage site GGATCC) and PvuI (CGATCG),

CTAGCGGGATCCATGGCTACGTGG                                                                                  
____________ATGGCTACGTGGCTGGGCATCCGAT...............................CGTACGTGGACTATTGA                    
____________TACCGATGCACCGACCCGTAGGCTA...............................GCATGCACCTGATAACA              
____________________________________________________________________GCATGCACCTGATAACACGATCGTGCATG


Top row is a possible forward primer design (5'->3'), second row is the sense DNA strand (for example)(5'->3'), third row is the anti-sense DNA strand (3'->5'), and last row is a possible reverse primer design (3'->5'). The forward primer has BamHI site (underlined) followed by a short stretch of the DNA of interest (sense). The reverse primer has PvuI site and a short stretch of the DNA of interest (anti-sense). The PCR product will then have both restriction sites in it. You can then digest the DNA fragment with the restriction enzymes. The extra (random) bases before the restriction sites are for efficient digestion because some restriction enzymes cannot digest DNA too near to the ends.

Is this a tutorial question or a practical application? I'm not sure if the DNA sequence you provided is the sequence you want to amplify 'cos for such a short sequence, you might as well synthesise the DNA fragment with the restriction sites included instead of PCR. If this is a tutorial question, replace the DNA sequence in the example here with your sequence to get your answer, provided I understood your question correctly.


#4 donny

donny

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 73 posts
3
Neutral

Posted 08 October 2010 - 06:31 AM

You've got the idea and is almost correct. However, there are a few problems.
(1)Your PCR won't work.
(2)The "final sequence after digestion with the two added restriction enzymes" you showed is only the PCR product. It hasn't been digested.

Since this is a tutorial question, I won't spoon feed you :)
Hint:
(1) Your reverse primer is missing something.
(2) The digested sequence is shorter.




Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.