Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

- - - - -

qRT-PCR for plant gene expression


  • Please log in to reply
4 replies to this topic

#1 Abiotic_Kabir

Abiotic_Kabir

    member

  • Active Members
  • Pip
  • 17 posts
0
Neutral

Posted 22 September 2010 - 11:13 PM

Hi there,

I am about to see gene expression in plant root. I need something to be clear since I am new in qRT-PCR.  

1) Which housekeeping gene would be suitable as internal control for qRT-PCR?

2) I have to use rotor gene 3000 cycler. Which kit would suitable for this machine?

3) Is one-step qRT-PCR  is easier than to-step?

4) I would see the expression of IRT1 gene. Someone used a pair of primer Arabidopsis IRT1 gene. can I use the same primer for other plant.

5) Which RNA isolation kit would be best for avoiding DNA contamination? Trizol or Qiagen?

Sorry for too many questions. I would be really grateful to have suggestions from you guys.

Cheers!
Kabir

Attached Files



#2 Trof

Trof

    Brain on a stick

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 943 posts
66
Excellent

Posted 23 September 2010 - 01:25 AM

1) (You mean reference gene) That depends on the treatment of your samples, the reference gene must have stable expression in all samples you run. Search the literature to find genes stable in roots or in your plant or papers that quantifies the same tyoe of samples, to see what they use. If you can't find any, you should try several reference genes presumably stable in your treatments and choose the best.

2) There are several manufacturers of qPCR mixes (Qiagen, Fermentas, Eurogentech, ABI, Roche...), they should specify if their mix is suitable for RotorGene 3000(capillary system, no ROX reference). I would start with the mix recomended by the cycler manufacturer.

3) One step qRT-PCR is quicker and one-tube, but you can use the transcribed RNA for sigle gene only. In two-step gRT-PCR you get amount of cDNA, that can be used for several genes (i.e. your target gene and reference), diluted, stored, thus the two-step is usually better. You need different kits for one-step and two-step.

4) Generaly no. Different species have different DNA/RNA sequence, check the sequences of the primers in BLAST to see what they bind.

5) You get some DNA contamination in both. If you use Trizol, you can lower the DNA contamination by using only the upper 2/3 of the aquaeous phase in the chloroform step and then use DNAse treatment to get rid of the rest (Ambion's (Turbo)DNA-free kit). For Qiagen kit you can buy additional DNAase to use on the column as a additional step in isolation. But in our experiences the Trizol-DNA-free method workes better.
Our country has a serious deficiency in lighthouses. I assume the main reason is that we have no sea.

I never trust anything that can't be doubted.

#3 Abiotic_Kabir

Abiotic_Kabir

    member

  • Active Members
  • Pip
  • 17 posts
0
Neutral

Posted 23 September 2010 - 06:03 AM

Thanks trof! Your suggestions would help me a lot...

#4 Abiotic_Kabir

Abiotic_Kabir

    member

  • Active Members
  • Pip
  • 17 posts
0
Neutral

Posted 24 September 2010 - 11:17 PM

Hi,
I got some questions again. I designed a pair of primers (qRT-PCR) for FRO1 gene expression study in Pisum sativum by
using primer3plus software.

Forward: TTGCATCATCACCAGAGGAA (Start:   449 Length:   20 bp Tm:   60.2 °C  GC:   45.0 % ANY:   4.0 SELF:   0.0)
Reverse: AGCCCAAACATTGGTAGCAC (Start:   602 Length:   20 bp Tm:   60.0 °C  GC:   50.0 % ANY:   5.0 SELF:   2.0 )

Product Size:   154 bp Pair Any: 4.0 Pair End: 0.0

Statistics:
Left Primer: considered 18425, GC content failed 385, low tm 8801, high tm 3883, high any compl 2, high end compl 6, long poly-x seq 103,high 3' stability 188, ok 5057
Right Primer: considered 18419, GC content failed 221, low tm 8558, high tm 4203, high end compl 3, long poly-x seq 107,high 3' stability 187, ok 5140
Primer Pair: considered 1722, unacceptable product size 1710, ok 12

What does it mean by GC content failed 385, low tm 8801, high tm 3883, considered 1722, unacceptable product size 1710, ok 12? Can you explain please?

Cheers!

#5 Trof

Trof

    Brain on a stick

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 943 posts
66
Excellent

Posted 29 September 2010 - 01:27 AM

Those statistics only describe how primer3 designs suitable primers, it starts (in this case) with 18 000 of them and then check them for the intended parametres. This information doesn't say anything important about the primers he picked, just that they (those "ok") passed all the tests, and how many good primers he found (in this case 12).

This statistics become important when the application fails to design any suitable primers, you can then read that those considered passed all the tests except for example GC content. Then you can decide that you change the parametres (set wider range of GS content) to get some primers.
The same with primers pairs, you may want a product close to 100 bp and you set the parameters for 80-110 bp product, but get no primers, you look at the statistics and see that primers failed the product size check, you can then set parameters for 70-120 bp and now you get a product sized 112 bp, that couldn't pass the tighter setting.
So basically, it's for troubleshooting when no primers are suitable.
Our country has a serious deficiency in lighthouses. I assume the main reason is that we have no sea.

I never trust anything that can't be doubted.




Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.