Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo

siRNA sequence can be used as shRNA?


  • Please log in to reply
1 reply to this topic

#1 Niraj

Niraj

    member

  • Active Members
  • Pip
  • 28 posts
0
Neutral

Posted 20 August 2010 - 11:35 AM

Hi Folks,

I am very new to siRNA and shRNA. I want to generate the lentivirus coding shRNA for down regulating the DYNLT1 expression.

Here is the DNA sequence of the DYNLT1:

ATGGAAGACTACCAGGCTGCGGAGGAGACTGCTTTTGTTGTTGATGAAGTGAGCAACATT
GTAAAAGAGGCTATAGAAAGCGCAATTGGTGGTAACGCTTATCAACACAGCAAAGTGAAC
CAGTGGACCACAAATGTAGTAGAACAAACTTTAAGCCAACTCACCAAGCTGGGAAAACCA
TTTAAATACATCGTGACCTGTGTAATTATGCAGAAGAATGGAGCTGGATTACACACAGCA
AGTTCCTGCTTCTGGGACAGCTCTACTGACGGGAGCTGCACTGTGCGATGGGAGAATAAG
ACCATGTACTGCATCGTCAGTGCCTTCGGACTCTCTATTTGA

The bold and underlined part is siRNA CCACAAAUGUAGUAGAACA used by PMID: 20690922. They have shown that siRNA can down regulate the DYNLT1 expression in siRNA transfected cells.

My question is can I use the same sequence as sense sequence and create shRNA oligo?

CCACAAATGTAGTAGAACATTCAAGAGATGTTCTACTACATTTGTGG

Italics and bold indicates hairpin.

Can above construct be able to downregulate the DYNLT1 expressing?

Thanks a lot for your time and suggestions.
Niraj

#2 Functional Screens

Functional Screens

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 118 posts
4
Neutral

Posted 28 August 2010 - 09:43 AM

The successful rate of si/sh-RNA conversion is not 100%.
U6 promoter prefers G as start and H1 promoter prefers A or G (C or T should be fine). Your siRNA sequence starts from C, so you might want to use H1 promoter.




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.