Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Bisulfite sequencing


  • Please log in to reply
3 replies to this topic

#1 bib

bib

    member

  • Members
  • Pip
  • 2 posts
0
Neutral

Posted 17 August 2010 - 04:32 AM

I would like to correlate change in promotor DNA methylation and a change in gene expression.
I have a lot of problem with my PCR amplification after bisulfite treatment.
The DNA region of theoretical CpG island is :
GCCAGGCTCTTCCCCCCGCCCCCGGAATCCCCCTCCAGTCCCGCTGCTC
GCAGCCTCAGTCCCGTCCTTGTCAGCCTCGCCTGGTCCTCCCTGCGGGCTAACCCTGTAT
TGCCTGTTGCACTCACCGCTCTCCGGGGTTTGTGACGCCTCTTCTGGGCCCCGGGGACCT
TCCTGGAGGAGCCTGGCCGTGCCAGCTCAAGCTGGAGGTGGGACATGAGGCAAATGGAAA
AGGCGAAGGACGAAGCCCCTCTCTGCATCTGCCCGTGGCCCTCCCAGCCGCAGACTCGAG
CCCGGATTTCAGGACACCCAGAGGACCCGACTCCGGTCTGGATGGGTTTTTCCGCTAAGC
AGGACAGATTGGCAAAGCGCTGGGGCTCGCCGTGGGCCTGAGGATGCAGAGAAGCTGGCG
GGGGAGAGGGGCGGCGGGGCGCGGCCGTCACTCACGCAGGCCGCCACATCCCTCCCC
GCGGCCGCCAGCAGCTCCAGGATCGGGCCGGCGCCGGGGAGCAGCTCCGAGCGGTGCAGGCCG
CTGAGCACTGCCTGGGCGTCCGCGATGCCCCGGGCCACGTGGCGGAGCCGAGCGCAGGAC
TGCGGGGACGAGAGGGCGTTAGAGCGGGCCGCGCCCGGGCCATGCCTCTCCCGCCCACTC
CCGGGCCTCACCGATGGCCGCGGAGGATCCCTCCTGGGGCGGAAGGAGCAGTTGCGCTGC
CCCCAGCTCAGCGCCTCTTCCTCCTGCGGGACAAGCGGCGCTTATCGCATACGGCTAGGC
CCCCTCGCCAGGGCCCCTAACCTCTGCACAGTCTGGGATTCCTGGACGTGGATGGGTACT
GGCAGCGCACGGTCGTGCCTGTCGTGTACTGAACCAGGGAGCTCCCCGAAGGCGCGAACC
AGGGTTGAATTGCACTCCGCGCTCCCCCAGCAAAGCCCCTCGCCCCGACCTGGAGCCGAG
TCCTCCCGGCAGGGCTCCCTTCTGTGATTGACCCTGAGCCTGCGTTCGCGCTGACGACGG
GGACTGCGGGGGTCTCGTGGTGGGAATTGTGGGCGCTGACATAGGAGAGGCGCCTGCTGG
GCGCTAGGACGCAGGACCCCTTGGGACAGGAACGGGTGTATGGGAACCCGGTGGGGCCAG
GGTCCCAGGGGGCACAGGGGCTGGGCGGTGACTTACGTAGCGGTCCCTCAGCGCCTTGGC
AGCCGCCAGCGTCCGGGGCTCCAGCGAGCGGTAGTGCGAGAGCAGGCAGCGCCGGGGGGC
CTTCTGCGATCACCGTGCACAGGACCCACAGCCCCGCGGCCACTGCGGCCCAGACACTCG
GCCGCATCTCTGCTTCTGCAGCAGGCGAGAGACGTCAGGGAAGCCAAAGAGAGGGTCCAG
CGCGTCCAGCCCCCCGCCTTGGGTTAGGATCCCAGGGAAGGCAATGCTCGGAGCGTGAAG
GCACAGCACACACAGTGGGAGAGAGAGTGGGAGCCGGCCCCCTCCTCGCCTTGGCCTCTG
CCCTCACTC
I would like to analyze all this region, but I think it's better to screen it with amplification of small fragments. I have tried to design primers with MethPrimer:
1- left primer TTGTATAGTTTGGGATTTTTGGA
right primer CAAAATCAATCACAAAAAAAA
2- left primer GTTTTAGGGGGTATAGGGGTTG
right primer ACATTACCTTCCCTAAAATCCTAAC
3- left primer TTTTAGGGGGTATAGGGGTTG
right primer CTAAACCCTCTCTTTAACTTCCCTAAC
I obtained amplification but sometimes not or multiple bands. I have tried to extract each band and to purify it and then to clone it in a pGEM vector. I obtained very beautiful sequences but I do not know what these sequence correspond to!!!
Could you help me? Do you think my primers are OK? Can I used another primers to study the methylation pattern of all the island?
Thanks a lot.....

Edited by bib, 17 August 2010 - 04:44 AM.


#2 methylnick

methylnick

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 245 posts
4
Neutral

Posted 17 August 2010 - 07:03 PM

Bib

did you try to marry your sequencing data to converted or unconverted sequences to your region of interest?

Does your region of interest consist of a potential repetitive sequence?

This could be why you are getting what you are getting.

nick

#3 bib

bib

    member

  • Members
  • Pip
  • 2 posts
0
Neutral

Posted 17 August 2010 - 09:46 PM

Hi Nick
Thanks a lot for your suggestions.
1- I did a sequence alignment with converted or unconverted sequences, without results.
Moreover I used BiQ Analyzer and I obtained only 35 % of sequence identities....
2- To my knowledge the region of interest does not consist of a potential repetitive sequence but could you give me a database which will allow me to verify?
I don't really understand why this could be an explanation.
Best,

Bib

Bib

did you try to marry your sequencing data to converted or unconverted sequences to your region of interest?

Does your region of interest consist of a potential repetitive sequence?

This could be why you are getting what you are getting.

nick



#4 methylnick

methylnick

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 245 posts
4
Neutral

Posted 20 August 2010 - 05:38 PM

you could try running your query through methblast.
http://medgen.ugent.be/methBLAST/




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.