Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

- - - - -

Blast Nucleotide Issue


  • Please log in to reply
3 replies to this topic

#1 hanming86

hanming86

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 156 posts
1
Neutral

Posted 10 August 2010 - 09:56 AM

Recently, whenever i compare bacteria DNA sequence against the blast nucleotide. using " others (nr/nt) " database, i can no longer obtain the " linkout" or the annotated gene ( gene ID) that supposedly come together with the comparison.

IN the end , i have to open the whole genome.. and take out the genome region that i wan according the the number(BOLDED) from the alignment and find the gene ID/CDS from there.

Query  35       TCGGCCCCGGCACGCCCGGCGGCAATCTGCTGCGTCGTTACTGGCAGCCCGTGGCCCTGG  94
                ||||||| ||||| ||| ||||  | ||| |||| |  || ||||| || ||||| ||||
Sbjct  2225376  TCGGCCCGGGCACTCCCTGCGGGCAGCTGATGCGCCAGTATTGGCAACCGGTGGCGCTGG  2225317

The NCBI staff insists that i am wrong. but i know it existed because i been doing alot of blast work before this.

IN this picture that i m uploading.. there's NO darkblue box with G to indicate genebank in the links area.

It's all empty. It used to be there when i did it last month.. and i had the " linkout" box ticked.

Attached Files


Lab + Coffee + Music = Bliss

#2 pDNA

pDNA

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 489 posts
14
Good

Posted 10 August 2010 - 11:41 AM

you are totally right ...a week ago or so there was a clear link to the gene associated with the hit sequence!

This feature is now missing ...and it was a very important feature to my point of view!!!

I think i should also contact the NCBI support to stress that this feature has to be reactivated!

Regards,
p

#3 hanming86

hanming86

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 156 posts
1
Neutral

Posted 10 August 2010 - 06:19 PM

View PostpDNA, on 10 August 2010 - 11:41 AM, said:

you are totally right ...a week ago or so there was a clear link to the gene associated with the hit sequence!

This feature is now missing ...and it was a very important feature to my point of view!!!

I think i should also contact the NCBI support to stress that this feature has to be reactivated!

Regards,
p

I did email the NCBI people, after discussing with the developers he said i could turn on "CDS feature" in the formatting option .. but i know it used to be way EASIER!

I wonder why they remove this particularly useful feature. it definitely saves more time.

Let me know what the NCBI people tell you. They usually reply pretty quickly. I was directed to a person called Dr Tao Tao.
Lab + Coffee + Music = Bliss

#4 Adrian K

Adrian K

    Legendary Graduate Beggar

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 684 posts
24
Excellent

Posted 11 August 2010 - 10:28 AM

Gosh... life is hard, and now become harder...
I use that to find all my required genes, gene names...etc, but now i can't anymore... duh....

Edited by adrian kohsf, 11 August 2010 - 10:30 AM.

Expecting the world to treat you fairly because you are a good person is like expecting the lion not to attack you because you are a vegetarian.

..."best of our knowledge, as far as we know this had never been reported before, though I can't possible read all the published journals on earth, but by perform thorough search in google, the keywords did not match any documents"...

"what doesn't kill you, makes you stronger"---Goddess Casandra reminds me to be strong

"It's all just DNA.  Do it."---phage434




Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.