2 replies to this topic

[jehane]

i have obtained this primer sequence from a paper

CCAAGGA(T/C)GGCAGCAGGCGCGAAA

what dies (T/C) mean?
should i order two primer and try both or what???

Thanks

[HomeBrew]

I would order that as "CCAAGGAYGGCAGCAGGCGCGAAA".  As I understand it, most primer synthesis companies will then provide you with a mixture that is ~50% "CCAAGGATGGCAGCAGGCGCGAAA" and ~50% "CCAAGGACGGCAGCAGGCGCGAAA" -- but call the company to be sure.  Why do you need the degeneracy?

[jehane]

HomeBrew, on 07 August 2010 - 02:15 PM, said:

I would order that as "CCAAGGAYGGCAGCAGGCGCGAAA".  As I understand it, most primer synthesis companies will then provide you with a mixture that is ~50% "CCAAGGATGGCAGCAGGCGCGAAA" and ~50% "CCAAGGACGGCAGCAGGCGCGAAA" -- but call the company to be sure.  Why do you need the degeneracy?

Thank u v ery much for reply.
this primer sequence appear in a published paper that we do the same PCR protocol