Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

primer sequence problem


  • Please log in to reply
2 replies to this topic

#1 jehane

jehane

    member

  • Active Members
  • Pip
  • 24 posts
0
Neutral

Posted 07 August 2010 - 12:12 PM

i have obtained this primer sequence from a paper

CCAAGGA(T/C)GGCAGCAGGCGCGAAA

what dies (T/C) mean?
should i order two primer and try both or what???

Thanks

#2 HomeBrew

HomeBrew

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 930 posts
16
Good

Posted 07 August 2010 - 02:15 PM

I would order that as "CCAAGGAYGGCAGCAGGCGCGAAA". As I understand it, most primer synthesis companies will then provide you with a mixture that is ~50% "CCAAGGATGGCAGCAGGCGCGAAA" and ~50% "CCAAGGACGGCAGCAGGCGCGAAA" -- but call the company to be sure. Why do you need the degeneracy?

#3 jehane

jehane

    member

  • Active Members
  • Pip
  • 24 posts
0
Neutral

Posted 08 August 2010 - 04:46 AM

I would order that as "CCAAGGAYGGCAGCAGGCGCGAAA". As I understand it, most primer synthesis companies will then provide you with a mixture that is ~50% "CCAAGGATGGCAGCAGGCGCGAAA" and ~50% "CCAAGGACGGCAGCAGGCGCGAAA" -- but call the company to be sure. Why do you need the degeneracy?


Thank u v ery much for reply.
this primer sequence appear in a published paper that we do the same PCR protocol




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.