Jump to content


- - - - -

Finding bisulfite PCR primer sequence


3 replies to this topic

#1 buccal_dave

    member

  • Members
  • Pip
  • 4 posts

Posted 05 August 2010 - 07:23 AM

Hello All,

I am having difficulty finding where my bisulfite converted primers are located on the Human iNOS gene on Chromosome 17.

My forward primer is: AATGAGAGTTGTTGTTGGGAAGTGTTT

My reverse primer is: CCACCAAACCCAACCAAACT

I really not sure where to start. I have tried using methBLAST, but have been unable to locate them.

If anyone can point me in the right direction, it would be greatly appreciated.

THANKS!

#2 pcrman

    Epigenetist

  • Moderator
  • PipPipPipPipPip
  • 815 posts

Posted 05 August 2010 - 01:34 PM

If the sequences are correct, methBlast should be able to find hits in the genome. Otherwise you have to download the promoter (assuming the primers are on the promoter) sequence of the gene, convert all non-cpg C to T in your text editor and then search for the primer sequences.

#3 buccal_dave

    member

  • Members
  • Pip
  • 4 posts

Posted 06 August 2010 - 12:25 PM

So I am still unable to find the sequence. I have copied my forward and reverse primers into methblast and it finds them on the gene. Then I click on the gene and locate the sequence where the primers should be located, copy that into my pyromark software which converts it to bisulfite converted sequence. Then I copy that sequence into microsoft word I am unable to find the primers.

What am I doing wrong?

#4 pcrman

    Epigenetist

  • Moderator
  • PipPipPipPipPip
  • 815 posts

Posted 06 August 2010 - 01:14 PM

Word is not a good editor to manipulate sequence data. If there is a break in the sequence, word won't give you a match.





Home - About - Terms of Service - Privacy - Contact Us

©1999-2011 Protocol Online, All rights reserved.