Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
- - - - -

Finding bisulfite PCR primer sequence

  • Please log in to reply
3 replies to this topic

#1 buccal_dave



  • Members
  • Pip
  • 4 posts

Posted 05 August 2010 - 07:23 AM

Hello All,

I am having difficulty finding where my bisulfite converted primers are located on the Human iNOS gene on Chromosome 17.


My reverse primer is: CCACCAAACCCAACCAAACT

I really not sure where to start. I have tried using methBLAST, but have been unable to locate them.

If anyone can point me in the right direction, it would be greatly appreciated.


#2 pcrman



  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,165 posts

Posted 05 August 2010 - 01:34 PM

If the sequences are correct, methBlast should be able to find hits in the genome. Otherwise you have to download the promoter (assuming the primers are on the promoter) sequence of the gene, convert all non-cpg C to T in your text editor and then search for the primer sequences.

#3 buccal_dave



  • Members
  • Pip
  • 4 posts

Posted 06 August 2010 - 12:25 PM

So I am still unable to find the sequence. I have copied my forward and reverse primers into methblast and it finds them on the gene. Then I click on the gene and locate the sequence where the primers should be located, copy that into my pyromark software which converts it to bisulfite converted sequence. Then I copy that sequence into microsoft word I am unable to find the primers.

What am I doing wrong?

#4 pcrman



  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,165 posts

Posted 06 August 2010 - 01:14 PM

Word is not a good editor to manipulate sequence data. If there is a break in the sequence, word won't give you a match.

Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.