Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

3' race


  • Please log in to reply
1 reply to this topic

#1 deespike

deespike

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 66 posts
0
Neutral

Posted 03 August 2010 - 07:00 AM

HI all

i am doing this gene isolation technique for the first time , here i need to perform the 3' race and 5' race in order to get the ends , i am having a doubt that the 3' end can be obtained with the oligo dt primers (anchored )only or the requirement of kit is a must.
plz help.

#2 Trof

Trof

    Brain on a stick

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,201 posts
110
Excellent

Posted 05 August 2010 - 03:01 AM

I had a RACE kit from Invitrogen (Gene Racer) and for 3' RACE only oligo dT primers with anchor complementary to 3' RACE primer were used from the kit. Here are the sequences.
dT primer: 5'- GCTGTCAACGATACGCTACGTAACGGCATGACAGTG(T)24 - 3'
3' RACE primer: 5'- GCTGTCAACGATACGCTACGTAACG - 3'

But the 5' RACE needs a ligation of special oligo and decaping of mRNA, so you maybe need the kit anyway.

Edited by Trof, 05 August 2010 - 03:03 AM.

Our country has a serious deficiency in lighthouses. I assume the main reason is that we have no sea.

I never trust anything that can't be doubted.

'Normal' is a dryer setting. - Elizabeth Moon





Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.