Jump to content


* * - - - 1 votes

Bisulfite sequencing not working!


  • You cannot reply to this topic
4 replies to this topic

#1 knockout

    member

  • Members
  • Pip
  • 3 posts

Posted 15 July 2010 - 06:41 AM

Hi all,

I have been trying get amplification from my bisulfite treated gDNA, but have had no luck so far and would really appreciate any help.

I am trying to assess the methylation status of a transgene by bisulfite sequencing. I have several primer sets that produces ~300bp PCR product for this transgene. The primers were designed manually by avoiding Cs within the primers to amplify both methylated and non-methylated regions (although there are typically one or two Cs in the primers, which becomes a degenerate primer).

I have good quality gDNA (confirmed by spec and gel), which are bisulfite treated using the QIAGEN Epitect kit or Sigma DNA modification kit. After bisulfite treatment, gDNA from both of the kits gives me degraded gDNA (500~3kb smear on a gel).

I used Phusion High fidelity DNA polymerase for all PCR following their instructions. Cycle conditions were: (1) 98degC for 10s, (2) 98degC for 10s, (3) 45~60degC for 30s, (4) 72degC for 30s, repeat (2)~(4) for 40 cycles, (5) 72degC for 10min, (6) 4degC hold.

I do not get ANY amplification from the bisulfite-treated gDNA after two rounds of PCR, but get good amplification from the non-treated gDNA (control). I have performed a gradient PCR using the bisulfite-treated gDNA ranging from 45degC to 68degC, and still do not get any amplification (the non-treated gDNA gives good amplification at most temperatures). Furthermore, I have mixed the bisulfite treated gDNA and non-treated gDNA to test for any PCR inhibition by the bisulfite treated gDNA. In a 20ul PCR reaction, 5/1/0.1ul of the bisulfite treated gDNA mixed with 50ng of non-treated gDNA, all inhibit PCR amplification. I have tried cleaning the bisulfite-treated gDNA through a spin column (HighPure kit from Roche), but still no amplification.

Has anyone tried mixing non-treated and bisulfite-treated gDNA to test for PCR inhibition or anything similar?

I would appreciate any advice that would get me a PCR product to sequence!!



Thank you in advance

#2 methylnick

    Veteran

  • Moderator
  • PipPipPipPipPip
  • 250 posts

Posted 16 July 2010 - 01:04 AM

Looks and sounds like your primer design is not very good. Can you post your sequences to see

#3 knockout

    member

  • Members
  • Pip
  • 3 posts

Posted 17 July 2010 - 04:56 PM

View Postmethylnick, on Jul 16 2010, 06:34 PM, said:

Looks and sounds like your primer design is not very good. Can you post your sequences to see



Below are couple of example sets of primers I have used. Forward 1 x Reverse 1 and Forward 1 x Reverse 2 combinations.

Forward 1: CTARTACCAACCCTATTTTCATTCTTC
Reverse 1: CTTCAAAAAATRRAACAACTTTACC
Reverse 2: CCTCTRACACATAATTCRCCTCTC

Sequence of the gene (luc): atggaagacgccaaaaacataaagaaaggcccggcgccattctatcctctagaggatggaaccgctggagagcaactgca
taaggctatgaagagatacgccctggttcctggaacaattgcttttacagatgcacatatcgaggtgaacatcacgtacgc
ggaatacttcgaaatgtccgttcggttggcagaagctatgaaacgatatgggctgaatacaaatcacagaatcgtcgtatg
cagtgaaaactctcttcaattctttatgccggtgttgggcgcgttatttatcggagttgcagttgcgcccgcgaacgacat
ttataatgaacgtgaattgctcaacagtatgaacatttcgcagcctaccgtagtgtttgtttccaaaaaggggttgcaaaa
aattttgaacgtgcaaaaaaaattaccaataatccagaaaattattatcatggattctaaaacggattaccagggatttca
gtcgatgtacacgttcgtcacatctcatctacctcccggttttaatgaatacgattttgtaccagagtcctttgatcgtga
caaaacaattgcactgataatgaattcctctggatctactgggttacctaagggtgtggcccttccgcatagaactgcctg
cgtcagattctcgcatgccagagatcctatttttggcaatcaaatcattccggatactgcgattttaagtgttgttccatt
ccatcacggttttggaatgtttactacactcggatatttgatatgtggatttcgagtcgtcttaatgtatagatttgaaga
agagctgtttttacgatcccttcaggattacaaaattcaaagtgcgttgctagtaccaaccctattttcattcttcgccaa
aagcactctgattgacaaatacgatttatctaatttacacgaaattgcttctgggggcgcacctctttcgaaagaagtcgg
ggaagcggttgcaaaacgcttccatcttccagggatacgacaaggatatgggctcactgagactacatcagctattctgat
tacacccgagggggatgataaaccgggcgcggtcggtaaagttgttccattttttgaagcgaaggttgtggatctggatac
cgggaaaacgctgggcgttaatcagagaggcgaattatgtgtcagaggacctatgattatgtccggttatgtaaacaatcc
ggaagcgaccaacgccttgattgacaaggatggatggctacattctggagacatagcttactgggacgaagacgaacactt
cttcatagttgaccgcttgaagtctttaattaaatacaaaggatatcaggtggcccccgctgaattggaatcgatattgtt
acaacaccccaacatcttcgacgcgggcgtggcaggtcttcccgacgatgacgccggtgaacttcccgccgccgttgttgt
tttggagcacggaaagacgatgacggaaaaagagatcgtggattacgtggccagtcaagtaacaaccgcgaaaaagttgcg
cggaggagttgtgtttgtggacgaagtaccgaaaggtcttaccggaaaactcgacgcaagaaaaatcagagagatcctcat
aaaggccaagaagggcggaaagtccaaattgtaa

These primer sets work fine at annealing temperatures between 50degC and 64degC using non-treated gDNA (i.e. sharp single band).


Thanks for your help!!

#4 methylnick

    Veteran

  • Moderator
  • PipPipPipPipPip
  • 250 posts

Posted 17 July 2010 - 10:15 PM

looks like your primers are targeting the reverse strand of converted DNA sequence of your region of interest.

I take it the R's are designed to conversion events meaning C/T or a G/A to which your primers are targeting the reverse strand. The actual primers themselves should not be degenerate at those sites and should be designed to converted DNA ie A in the primers for your examples.

I don't think they are good enough to amplify bisulphite converted DNA. There are very few conversion events your primers target to, and it makes sense they are working on non-converted DNA.

A primer redesign would be the easiest thing to do. You need to ensure your primers selectively amplify converted DNA and they should hybridise to many C's that are converted to T's. at least one should be on the 3'end of your primers.

I would suggest using methyl primer express to pick your primers. and check out my primer design notes on the stick.

Nick

#5 knockout

    member

  • Members
  • Pip
  • 3 posts

Posted 08 September 2010 - 06:22 AM

I apologize for the late reply... and thank you very much for your help!! I have bands to sequence and is looking good!!

Thank you once again



Knockout





Home - About - Terms of Service - Privacy - Contact Us

©1999-2011 Protocol Online, All rights reserved.