Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

PgemT-Easy sequencing primers, please rate


  • Please log in to reply
2 replies to this topic

#1 manny

manny

    member

  • Members
  • Pip
  • 2 posts
0
Neutral

Posted 13 July 2010 - 09:39 PM

Hi all,

I am deciding what primers to use to sequence my inserts from the PGemT-easy cloning vector. I want to reduce the unwanted sequence reads (ie or the primers) but get the whole of my 16S insert..as the first few sequence reads are not always reliable I want to choose a primer that is near the edge of the vector ends..but dont want to use a 16S primer sest (such as a 616V, 1492R pair).
The options available are SP6-T7 pair, M13R-M13F pair, or any other primer pairs anyone may have used with success!

Cheers

Manny :lol:

#2 Rsm

Rsm

    Post Dog

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 376 posts
8
Neutral

Posted 14 July 2010 - 12:40 AM

I have used
For GATGTGCTGCAAGGCGATTA
Rev CTTCCGGCTCGTATGTTGTG
with good results... But they are a bit farther away from the cloning site (bc that's what I wanted...).

Cheers.,

Minna
I got soul, but I'm not a soldier

#3 manny

manny

    member

  • Members
  • Pip
  • 2 posts
0
Neutral

Posted 19 July 2010 - 03:21 PM

Thanks, heaps

M




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.