Hi all,
I'm trying to amplify a 1kb/3kb fragment off of a region of C. elegans genome that has very high GC content. The primers provided are "weird" in terms of having lots of single nucleotide repeats (e.g. aaaa or cccc). I tried a few different mixes (mostly changing Mg concentration and primer/template concentration) at different annealing temperature but the desired bands don't show up at all. Instead, I either get no band or non-specific bands, all of which smaller than the target.
Should I keep working with these primers or design some new ones, or should I just try a few more mixtures/Taq? Any hints or suggestions are welcome. Thanks a lot pplz!!
PCR genomic DNA of high GC content
Started by sanguinara, Jul 07 2010 09:49 AM
6 replies to this topic
#1
Posted 07 July 2010 - 09:49 AM
#2
Posted 07 July 2010 - 03:33 PM
Add 5% of a 1 M betaine solution.
#3
Posted 07 July 2010 - 07:24 PM
Or you can with try 5% DMSO... But i think betaine works better.
Expecting the world to treat you fairly because you are a good person is like expecting the lion not to attack you because you are a vegetarian.
..."best of our knowledge, as far as we know this had never been reported before, though I can't possible read all the published journals on earth, but by perform thorough search in google, the keywords did not match any documents"...
"what doesn't kill you, makes you stronger"---Goddess Casandra reminds me to be strong
"It's all just DNA. Do it."---phage434
..."best of our knowledge, as far as we know this had never been reported before, though I can't possible read all the published journals on earth, but by perform thorough search in google, the keywords did not match any documents"...
"what doesn't kill you, makes you stronger"---Goddess Casandra reminds me to be strong
"It's all just DNA. Do it."---phage434
#6
Posted 08 July 2010 - 02:42 PM
What are the actual conditions you're using? Primer sequences? Calculated Tms? For high GC templates, I go with the very basic 4x(G+C) = 2x(A+T) equation; it seems to work well.
Heart disease kills more women than breast cancer, but heart attack symptoms differ from men's symptoms. Get to know your heart... it could save your life.
#7
Posted 14 July 2010 - 04:32 PM
swanny, on Jul 8 2010, 03:42 PM, said:
What are the actual conditions you're using? Primer sequences? Calculated Tms? For high GC templates, I go with the very basic 4x(G+C) = 2x(A+T) equation; it seems to work well.
There are 2 pairs of primers: cagtgcctttagggcttgag/ggggtactgtggctgaaaaa and taaatcaaacgcccttggaa/aaacgaaaacccggagaaat. The Tms are calculated to be around 56 degrees (first pair) and 52 degrees (second pair). The region itself is where the problem is: high GC content and lots of repeats... I've tried betaine like suggested and annealing temperature from 48 degrees to 60 degrees, with combination of various concentration of Mg, primer, template, you name it.. Still, with cheap Taq it shows a crapload of non-specific bands but not the target, and with Hifi Taq there would be no band.













