4 replies to this topic

[cells]

Hi, I was wondering if someone could help me with this.  I am fairly new to RT-PCR (and PCR in general) and I'm trying to learn all the basics of primer design and testing.  

Recently, I designed a set of GAPDH primers using Primer-Blast but for some reason I am getting extremely high efficiencies when I run a standard curve with these primers.  I was wondring if someone could look over the primer sequence and let me know if there may be problems with the sequence itself.

The sequence is:
Fw: TGTTCGACAGTCAGCCGCATCTTC
Rv: GGTGACCAGGCGCCCAATACG

I did a gradient intially with these primers from 55-65 oC and they seemed to be fine at all temperatures but when I ran a 10x standard curve the efficiency was around 135%.  I would imagine trying to design reference gene primers would be the easier task but I guess I've been proven wrong.

If anyone could please help me out that would be great.


Thanks!

[cells]

BTW, would concentration of primers in the reaction mixture affect standard curve?

[Curtis]

It would give you primer dimers at the bottom of the gel.
I also designed my GAPDH by primer-blast at NCBI.

use 1.5ul of 10pmol of working solution primers for every 50ul reaction.

Are you doing Real-Time PCR?

cells, on Jul 6 2010, 08:01 AM, said:

BTW, would concentration of primers in the reaction mixture affect standard curve?

[cells]

Hi, thanks for the reply.

Yes, I am doing real-time PCR and I had been using 500nM final concentration of each primer in those reactions.

When I did normal gradient PCR, I used 2uL of a 10uM primer solution in a final volume of 50uL...do you think this is too high?

[cells]

Hi again, would it be possible for anyone to help me check if this primer pair is leading to any gDNA contamination (which could probably give rise to the higher efficiency).

I did a nucleotide Blast with these sequences and I'm getting some E values that are pretty low under genomic sequences...is this cause for any big concern?