15 replies to this topic

[Fhannan]

The exact band size of my PCR that  i want is around 305bp...but i am getting another band which is 20-30bp less than the band size that i should get. I have 2 band in my PCR product!!!I don't know what reason that cause this and anyone here can explain to me? Please!

[galileo]

Fhannan, on May 22 2010, 08:05 AM, said:

The exact band size of my PCR that  i want is around 305bp...but i am getting another band which is 20-30bp less than the band size that i should get. I have 2 band in my PCR product!!!I don't know what reason that cause this and anyone here can explain to me? Please!

It means, that u have one specific and one nonspecific band in ur PCR? Did u try to optimize it? To increase annealing temperature, or decrease primer concentration, or to use some additives? If so, isnt it some contamination there (DNA from other species for example)?

[Fhannan]

Thanks for the answer,
I am doing two reaction for 2 fragments, the PCR product for one fragment is showing two bands, while the other shows one specific band only, so i guses it is not contamination problem that we are talking about here, regarding the annealing temp i am using two primers one with 59.4 C, the other is 55.3 i am running my reaction with 52C annealing temp with 0.2uM final primer conc. do these conditions seem fine?

[galileo]

Fhannan, on May 22 2010, 09:40 AM, said:

Thanks for the answer,
I am doing two reaction for 2 fragments, the PCR product for one fragment is showing two bands, while the other shows one specific band only, so i guses it is not contamination problem that we are talking about here, regarding the annealing temp i am using two primers one with 59.4 C, the other is 55.3 i am running my reaction with 52C annealing temp with 0.2uM final primer conc. do these conditions seem fine?

Did u try temperature gradient? U can try also BLAST, to verify your primers. Do u have some PCR troubleshooting? It can helps u, if u dont know what to do (for example this one: http://www.abgene.co....ting_Guide.pdf).

[hobglobin]

Perhaps DNA from a heterozygous organism?

[Fhannan]

Its Human DNA samples...

[swanny]

Have you done a check for potential secondary binding sites? Is it possible to  raise the tm of the 55 degree primer? Even adding 1 base to bring the Tms closer will mean you can run with a higher annealing temp, and reduce the risk of mispriming. Also, what [Mg2+] are you using?

[Fhannan]

Hello,
i am using 1.5mM Mg+2 conc. i have been trying to optimize the reaction by increasing annealing temp to 55 and 58 and decreasing primer and DNA template with no luck!

[jamessmith01]

Did you still get the two bands at Ta=58ºC?

Try increasing the Ta even further. If you continue to see the two bands, at the same brightness, then it might be due to a specific, second target region in the genome (check this by BLAST or in-silico PCR). Alternatively there might be a heterozygous deletion in your DNA sample.

You could re-design your primers and/or cut out, gel-purify and sequence your bands. At least you'll then know for sure where this second product is coming from.

[Fhannan]

I checked by blast that only one fragmet should be amplified..
I have tried to optimize the protocol, in all cases I got either no amplification or unspecific amplification in 2-3 banding pattern. I tried to use the following ranges of :
- 0.5, 1, 1.5, 2, 3ul of primers
- 50ng (0.2ul), 100ng (0.5ul), 300ng (1.5ul) of DNA
- 5ul, 6ul 6.7ul of 10xbuffer with mgcl2 which gives the following final Mg+2 conc. respectively 1.5mM, 1.8mM, 2.1mM
I carried out the reaction under 55C which I saw the it gives better bands comparing with 52C, 58C, 62C
Are there any suggestion that could improve the results, I attach a gel photo that shows the unexpected bands

The Std protocol is as follow
dNTPs 1ul (200uM)
Primers 2ul (02uM)
10x buffer 5ul
DNA 1ul (5-100ng)
Enzyme 0.5ul
dH2O 40.5ul
Total 50ul



Primers annealing temp is
45F 59.4 C
45R 55.3 C

[Maddie]

Can you give us the sequence of the 305bp fragment as well as the primer's? Maybe the primers binds inside your fragment, even if it's only a few bp.

[Fhannan]

Here it is: upper case letters represent primers

TGTGTGTGTGGGGTCTGTCT TGTGATGAAAGAGGCCAGAA TGTGTGTGTGGGGTCTGTCTctccatggctgacagtgcacatgtggattc cagggctcaggatgctgttgctgggagctgttctactgctattagctctg cccggtcatgaccaggaaaccacgactcaagggcccggagtcctgcttcc
cctgcccaagggggcctgcacaggttggatggcgggcatcccagggcatc cgggccataatggggccccaggccgtgatggcagagatggcacccctggt gagaagggtgagaaaggagatccaggtaagaatgtTTCTGGCCTCTTTCATCACA

[Fhannan]

Here it is: upper case letters represent primers

TGTGTGTGTGGGGTCTGTCTctccatggctgacagtgcacatgtggattc cagggctcaggatgctgttgctgggagctgttctactgctattagctctg cccggtcatgaccaggaaaccacgactcaagggcccggagtcctgcttcc
cctgcccaagggggcctgcacaggttggatggcgggcatcccagggcatc cgggccataatggggccccaggccgtgatggcagagatggcacccctggt gagaagggtgagaaaggagatccaggtaagaatgtTTCTGGCCTCTTTCATCACA


I`d appreciate any comments....

[perneseblue]

Could you try decreasing the Mg concentration to 1mM? More Mg means less specificity/higher activity, while  lower Mg concentration means more specificity and less enzyme activity.

you could try digesting your template DNA with one or more restriction enzymes which cuts outside the region you want to amplify. That should hopefully remove any secondary primer binding sequence.

Lastly, what actually do you want to do with that PCR product? You must always remember why you are doing what you are doing. If this is for cloning, a perfect PCR is not required. Only something which is good enough.

Just gel purifying on 3% agarose, and once the fragment has been inserted, screen several colonies by RE and DNA sequencing for the correct insert.

[Fhannan]

Thanks for the input, i need the PCR to do RFLP, the thing is that  i cant do the resrtiction reaction until i optimize my reaction to get single band as the expected band obtained after digestion migh interfere with the second band i got after PCR, they almost have the same size 80-90bp.