Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

First time using sequencher


  • Please log in to reply
1 reply to this topic

#1 new2science

new2science

    member

  • Active Members
  • Pip
  • 9 posts
0
Neutral

Posted 04 May 2010 - 12:15 PM

Hi, I am interested in sequencing and so I have finally got my "raw" sequencing results from DNA core. I went through sequencing through a few patients that I am interested in seqeuncher and basically the task that I want to do is look at hypermutation. So, this website I am using tells me that I need to paste an alignment but I keep on geetting an error. I don't think I am putting the right thing into the program. Program is called hypermut 2.0 Maybe, I should ask first is what is an alignment?

#2 HomeBrew

HomeBrew

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 930 posts
15
Good

Posted 04 May 2010 - 06:59 PM

Maybe, I should ask first is what is an alignment?



Here is am image of an alignment of two DNA sequences. It was produced by ClustalW2. You need to have your DNA sequences in a text file, in FASTA format, which looks like this:

>sequence1 Everything after the first space is a comment that describes sequence1.
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCC
CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGC
CTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGG
AAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCC
CTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAG
TTTAATTACAGACCTGAA
>sequence2 The name/comment line of the sequence must begin with a ">" character
ACCGGCCGAGACAGCGAGCATATGCAGGCCTGGAGGGTGGCCCCAAGCGGCAGGAATAAGGAAAAGCAGC
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCC
CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGC
CTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGG
AAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCC
CTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAG
TCACCCATGAATGCTTTTAATTACAGACCTGAA


etc...




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.