Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

Designing siRNA from Sequence provided by Qiagen


  • Please log in to reply
4 replies to this topic

#1 bluedoozer

bluedoozer

    member

  • Active Members
  • Pip
  • 13 posts
0
Neutral

Posted 27 April 2010 - 09:38 PM

Hello everybody,
I have a question: I got a datasheet from qiagen for a gapdh siRNA with the following target sequence: CCGAGCCACATCGCTCAGACA

I wondering how to use this sequence to design my siRNA next time the vial is empty from qiagen. Using Sigma I can get the siRNA for half the prize, but I need to enter the sequence. So how to do this??? Just use this mRNA target sequence of GAPDH and make it reverse complement using U instead of T  ??????

Do I need to modify the ends???

Thanks for you help in advance.

Itīs really necessary to order this at Sigma for the cheaper prize, since our lab run out of money, and we need to perform this experiments as soon as possible.

#2 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,015 posts
43
Excellent

Posted 27 April 2010 - 10:31 PM

Since the target sequece is 21 nt while standard siRNA has a target sequence of 19nt plus two nt overhangs. You can leave out the first two bases and order your siRNA duplex from sigam as follows:

target: GAGCCACATCGCTCAGACA

siRNA duplex:
sense:       GAGCCACAUCGCUCAGACA[dT][dT]
antisense: UGUCUGAGCGAUGUGGCUC[dT][dT]

It should work.

#3 bluedoozer

bluedoozer

    member

  • Active Members
  • Pip
  • 13 posts
0
Neutral

Posted 28 April 2010 - 02:11 AM

Thank you very much for your fast reply.
Why can I leave out the first 2 bases?
Are they not necessary ??

So the Target Sequence provided by the company is mainly the sense strand, without the first 2 ologios, but instead at the end 2dTīs.
Can you explain me this? Iīm not so advanced to get this point. Just a beginner in siRNA. Sorry

Thanks in advance

#4 Functional Screens

Functional Screens

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 118 posts
4
Neutral

Posted 28 April 2010 - 06:56 AM

I think you better confirm whether your siRNA sequence CCGAGCCACATCGCTCAGACA is identical to your target mRNA sequence.  If so, you might want to take the first 19-nt (the last 2 nt CA will be the overhang).  You can replace CA with dTdT, but you can also just use CA.  It does not matter that much.  Your antisense strand will be UGUGAGCGAUGUGGCUCGGdTdT.  The dTdT can be replaced with the nucleotides complementary to the target mRNA as well.

Edited by Functional Screens, 28 April 2010 - 06:56 AM.


#5 bluedoozer

bluedoozer

    member

  • Active Members
  • Pip
  • 13 posts
0
Neutral

Posted 28 April 2010 - 12:24 PM

Thanks alot for your replies.

I can confirm, the sequence is matching 100% to the mRNA from GAPDH (human)
So the only thing I have to do is to copy/paste the sequence as sense to the ordering sheet, ok also the antisense and thatīs it? no hidden clue?
Sounds quite simple.

Thanks again

I will give it a try.

But.....
why is one scientist talking about cutting the first 2 and one scientist wants to cut the last two bases of the sequence?
Is it just important to keep the 19 bases? Are the dTīs very important and what is their function?

Thanks




Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.