Jump to content


How to retrieve precursor miRNA sequence with extra bases for cloning


  • You cannot reply to this topic
4 replies to this topic

#1 newmirnaman

    member

  • Active Members
  • Pip
  • 7 posts

Posted 23 April 2010 - 07:48 PM

I want clone a miRNA.
Before I can find the flank sequence, but now I can not.
Where can I find the sequence?
Thanks.

#2 pcrman

    Epigenetist

  • Moderator
  • PipPipPipPipPip
  • 815 posts

Posted 23 April 2010 - 10:11 PM

For cloning precursor miRNA, usually you need to include about 100 bp sequence upstream and downstream of the precursor miRNA. There are many ways of obtaining the genomic sequence. One way is to use ensemble website. For example, i want to clone human miR-21 pre-miRNA.

  • go to ensembl.org
  • Search hsa-mir-21 using the search box and choose human from the species and get this page
  • Click the link under "By Species" -> Human -> Gene
  • Listed is the miR-21 link which appears as Ensembl miRNA Gene: ENSG00000199004 (miRBase: hsa-mir-21) [Region in detail]
  • Click the link which leads to this page http://uswest.ensembl.org/Homo_sapiens/Gen...ENSG00000199004
  • Click the link "Sequence" found on th left column of the page. The genomic sequence for miR-21 will be displayed with pre-miR-21 sequence displayed in red. Now the upstream and downstream sequences may not be the desired size.
  • To ask the database to export the size you desire, click "Configure this page" on the left of the page, a popup window will appear. In the top two fields named as "5' Flanking sequence (upstream)" and "3' Flanking sequence (downstream) ", input 100 and 100, and click "Save and close". This will tell the database to only export 100 bp upstream, the pre-miR and 100 bp downstream sequence.
  • After that, the page will reload with the desired sequence displayed as shown below or can be found here
>chromosome:GRCh37:17:57918527:57918798:1
GTTTTTTTGGTTTGTTTTTGTTTTTGTTTTTTTATCAAATCCTGCCTGACTGTCTGCTTG
TTTTGCCTACCATCGTGACATCTCCATGGCTGTACCACCTTGTCGGGTAGCTTATCAGAC
TGATGTTGACTGTTGAATCTCATGGCAACACCAGTCGATGGGCTGTCTGACA
TTTTGGTA
TCTTTCATCTGACCATCCATATCCAATGTTCTCATTTAAACATTACCCAGCATCATTGTT
TATAATCAGAAACTCTGGTCCTTCTGTCTGGT

#3 pcrman

    Epigenetist

  • Moderator
  • PipPipPipPipPip
  • 815 posts

Posted 23 April 2010 - 10:29 PM

You can also retrieve genomic sequence from UCSC database:

  • Go to UCSC genome database -> Genome Browser
  • Choose the genome (human, mouse, etc) and type hsa-miR-21 or mmu-miR-21 (for example) [note: The 2009 Feb human genome assebly has not annotated miRNA yet!, so choose the 2006 assembly if you search human miRNA]
  • On the result page, click the link for miR-21 and get this page ,
  • Click the link "DNA" on the top of the page
  • On the next page, in the box "Sequence Retrieval Region Options: " type the number of desired extra bases, for example 100
  • If the miRNA is transcribed from the minus strand, check the box "Reverse complement (get '-' strand sequence) "
  • Click get DNA.


#4 Functional Screens

    Veteran

  • Active Members
  • PipPipPipPipPip
  • 118 posts

Posted 24 April 2010 - 07:02 AM

View Postpcrman, on Apr 23 2010, 10:29 PM, said:

You can also retrieve genomic sequence from UCSC database:

choose "blat"
copy miRNA precursor sequence obtained from mirbase.org to blat genome.
it gives you 100bp flanking sequences on both 5' and 3' ends.

Edited by Functional Screens, 24 April 2010 - 07:03 AM.


#5 gingerblack

    member

  • Active Members
  • Pip
  • 5 posts

Posted 07 December 2011 - 10:58 PM

is the 100bp value indicated is a necessity? i have heard colleagues have different ideas some clone the exact length of precursor with some nucleotides up and downstream, some 500nt and some other 1kb
please introduce me a reference about this issue





Home - About - Terms of Service - Privacy - Contact Us

©1999-2011 Protocol Online, All rights reserved.