Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

annotate DNA sequence


  • Please log in to reply
No replies to this topic

#1 crouch88

crouch88

    member

  • Members
  • Pip
  • 1 posts
0
Neutral

Posted 19 April 2010 - 06:44 PM

Hey guys. It would be awesome if you could help me with this question. I have absolutely no clue how to go about it. :lol:

Consider the following DNA sequence:
AATATCAATGAATGTCATAGTGTCACTAAGGATGC

Assume you have available the follwing resources to hand-annotate the sequence above:

EST E1 (expressed sequence tag): CAATGAATTG
EST E2: CCTTAGT
Proteins: Met Asn Cys His

Identify:
5' UTR
3' UTR

And the full length mRNA.

Edited by crouch88, 19 April 2010 - 06:44 PM.





Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.