Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

MS-PCR, big problems-))


  • Please log in to reply
No replies to this topic

#1 Evgeny Denisov

Evgeny Denisov

    member

  • Active Members
  • Pip
  • 10 posts
0
Neutral

Posted 18 March 2010 - 12:25 AM

Hi friends,

Pls, help me in the following problem.
I perform MS-PSR. TP53 gene, exon 4.
Methylated primers (primers to methylated sequence) are annealing to negative control (non-methylated sequence, DNA from health people). May be I selected incorrect primers. I don't know what is problem!

Pls, see

Original sequence
TTTTCACCCATCTACAGTCCCCCTTGCCGTCCCAAGCAATGGATGATTTG ATGCTGTCCCCGGACGATATTGAACAATGGTTCACTGAAGACCCAGGTCC
AGATGAAGCTCCCAGAATGCCAGAGGCTGCTCCCCCCGTGGCCCCTGCAC CAGCAGCTCCTACACCGGCGGCCCCTGCACCAGCCCCCTCCTGGCCCCTG
TCATCTTCTGTCCCTTCCCAGAAAACCTACCAGGGCAGCTACGGTTTCCG TCTGGGCTTCTTGCATTCTGGGACAGCCAAGTCTGTGACTTGCACGGTCA
GTTGCCCTGAGGGGCTGGCTTCCATGAGAC

Non-methylated sequence
TTTTTATTTATTTATAGTTTTTTTTGTTGTTTTAAGTAATGGATGATTTG ATGTTGTTTTTGGATGATATTGAATAATGGTTTATTGAAGATTTAGGTTT
AGATGAAGTTTTTAGAATGTTAGAGGTTGTTTTTTTTGTGGTTTTTGTAT TAGTAGTTTTTATATTGGTGGTTTTTGTATTAGTTTTTTTTTGGTTTTTG
TTATTTTTTGTTTTTTTTTAGAAAATTTATTAGGGTAGTTATGGTTTTTG TTTGGGTTTTTTGTATTTTGGGATAGTTAAGTTTGTGATTTGTATGGTTA
GTTGTTTTGAGGGGTTGGTTTTTATGAGAT

Methylated sequence
TTTTTATTTATTTATAGTTTTTTTTGTCGTTTTAAGTAATGGATGATTTG ATGTTGTTTTCGGACGATATTGAATAATGGTTTATTGAAGATTTAGGTTT
AGATGAAGTTTTTAGAATGTTAGAGGTTGTTTTTTTCGTGGTTTTTGTAT TAGTAGTTTTTATATCGGCGGTTTTTGTATTAGTTTTTTTTTGGTTTTTG
TTATTTTTTGTTTTTTTTTAGAAAATTTATTAGGGTAGTTACGGTTTTCG TTTGGGTTTTTTGTATTTTGGGATAGTTAAGTTTGTGATTTGTACGGTTA
GTTGTTTTGAGGGGTTGGTTTTTATGAGAT

Primers
Mt
F 5' TTGATGTTGTTTTCGGACGATA 3' (22)
R 5' AAACCGCCGATATAAAAACTACTA 3' (24)
PCR product 127 bp

UnMt
F 5' TTGGATGATATTGAATAATGGTTT 3' (24)
R 5' ACCACCAATATAAAAACTACTAATACAA 3' (28)
PCR product 113 bp

Thanks in advance for your help!




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.