Hii....
I have been trying to get my BS PCR work for sometime now but their seems to be some problem with the PCR. Here are the details of the experiment which i carry out:
1) Bisulfite conversion and subsequent clean up using Epitech Bisulfite kit (Qiagen). I am following exactly the same protocol as mentioned by Qiagen.
2) Quantitation of ssDNA using nanodrop. I generally get DNA concentration around 100ng/ul. ( i suppose i,m on right path till this step).
3) Next step is PCR:Amplicon size is about 900bp
Primers: 5' TATTATTTTGAGGAAGAGGGTTTT 3' (Forward) Tm: 49.9C
5' CAAAAAATAAAACTAAAATCATACA 3' (Reverse) Tm:55 C
PCR thermal profile:
94C for 5mins
35cycles for
94C/1min
60C/55C/50C/1min each
72C/1min
72C/10mins.
PCR master Mix:
300ng of bisulfite treated DNA.
200uM each dNTP.
10pmols of each primer,
Ordinary Taq pol.
MgCl2 titration with final concentration ranging from 1.5mM to 3mM
At times,I have also added BSA or DMSO to enhance PCR.
I have tried several thermal profiles, but result is always the same....NO AMPLIFICATION. The primers used are already published and the researcher has mentioned use of Invitrogen AccuPrime Taq Pol. Am i not getting the results because of the ordinary Taq pol which I am using?
At this point, I really can't understand where am I going wrong.
Any suggestion as to what changes should I make would be appreciated.
Thanks,
Jasmine.
Unsuccessful BS PCR
Started by Jasmine, Mar 08 2010 09:34 AM
3 replies to this topic
#1
Posted 08 March 2010 - 09:34 AM
#2
Posted 09 March 2010 - 06:22 AM
Hey Jasmine,
I have done a fair bit of bisulphite sequencing over the last year or so... In my experience 900 bp is rather a large amplicon, especially if you are only just starting out with the technique, generally protocols suggest a maximum of 500 bp although I have heard of people amplifying as long as 2 kb. For an amplicon of your size I would suggest you increase the number of cycles to 45 or even better carry out a second round of PCR using nester primers in order to increase the probability of seeing your product.
Finally, I would suggest that checking your DNA concentration on a spec after carrying out BS treatment is not very reliable. BS treatment is very harsh on genomic DNA and causes massive amounts of degradation therefore a lot of the DNA you detect by spec will be un-amplifiable anyway!
Hope that helps,
Jon
I have done a fair bit of bisulphite sequencing over the last year or so... In my experience 900 bp is rather a large amplicon, especially if you are only just starting out with the technique, generally protocols suggest a maximum of 500 bp although I have heard of people amplifying as long as 2 kb. For an amplicon of your size I would suggest you increase the number of cycles to 45 or even better carry out a second round of PCR using nester primers in order to increase the probability of seeing your product.
Finally, I would suggest that checking your DNA concentration on a spec after carrying out BS treatment is not very reliable. BS treatment is very harsh on genomic DNA and causes massive amounts of degradation therefore a lot of the DNA you detect by spec will be un-amplifiable anyway!
Hope that helps,
Jon
Edited by jonny_boy, 09 March 2010 - 06:39 AM.
#3
Posted 09 March 2010 - 06:25 AM
Just realised something else... DMSO should not really be necessary as it is normally used for GC rich templates which are entirely the opposite to what BS treatment produces! One more tip as well, consider putting a small amount of proof-reading polymerase in your reactions along with your standard taq, I find a mixture of Taq and Pfu in a ratio of 15:1 works nicely. Rumour has it extending at slightly lower temperatures (down to about 65) helps with amplification through AT rich templates as well.
#4
Posted 09 March 2010 - 09:02 AM
I agree to jonny_boy: make your PCR shorter. 900 bp is quite a lot for a BS-PCR. Also try to design primer which have similar melting temps. A difference of more than 5 degC could have a negative influence on the PCR performance. Don't waste your DNA, 10 to 25 ng per PCR should be enough. Instead increase the number of cycles to 40 or 45.
Best
MoB
Best
MoB













