4 replies to this topic

[methdetector]

Hello,

I did PCR using my treated plant gDNA using the following primers and obtained clear bands. I cloned and sequenced and saw there are no C to T conversions! But the mystery to me is that the universal methylated control I used in conjunction with Methylation-Gold Kit seems to be showing the conversion.

Promoter region of my gene:
AAGGCGATATTTGGTGAAAAAGAATGGTACTTCTTTAGTCCTAGAGACCGTAAGTACCCAAATGGATCCCGACCCAATAGGGTTGCCGGGTCTGGGTATTGGAAGGCCA
CCGGTACTGATAAAATTATCACATCAGATGGACGTAAAGTAGGTATCAAGAAAGCTCTCGTCTTTTACATTGGCAAGGCCC
CAAAAGGAACCAAAACTAATTGGATCATGCATGAATACCGCCTTATTGAATCCTCTCGCAAACATGGAAGCACGAAGGTAC
CAACGAAAGAAATTCCACCTGCAGATTAATTTTAATTTGTTTTGATACGCCTCAATATTAATTAATGATTTTTGTTAATTT
TCTTTGTTGTTACAGTTGGACGAATGGGTATTGTGTCGGATTTATAAGAAGAAAT

Primers used
Forward: AAGGYGATATTTGGTGAAAAAGAATGGTA
Reverse: ATTTCTTCTTATAAATCCRACACAATACCCATTC

It would be very helpful if someone could help me with this. My question is as to why there is no C to T conversion. Is it possible that all Cs are methylated?

Thank you in advance! I'd appreciate any suggestion.

[pcrman]

There are two possibilities:

1. Your DNA was not converted.

2. The primer design appears to me to be bad because neither primer contains sufficient non-cpg 'C's, thus allowing no discrimination against non-converted DNA. This possibility is more likely.

[methdetector]

Thank you very much for your reply. I really appreciate it.

pcrman, on Feb 17 2010, 10:32 PM, said:

There are two possibilities:

1. Your DNA was not converted.

2. The primer design appears to me to be bad because neither primer contains sufficient non-cpg 'C's, thus allowing no discrimination against non-converted DNA. This possibility is more likely.

[et2b]

Test your primers also on genomic DNA, good BS specific primers dont give a product. And indeed BS primers should at least contain 3 non CpG "C" and for sequencing preferably no CpG sites in the primers.
best
et2b

[methylnick]

I agree with the others with regard to the primer design.

But also, plants have non-CpG methylation as well so how would you be able to tell that from non-conversion?

Nick