Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

All cytosines are methylated!!


  • Please log in to reply
4 replies to this topic

#1 methdetector

methdetector

    member

  • Active Members
  • Pip
  • 11 posts
0
Neutral

Posted 01 February 2010 - 03:24 PM

Hello,

I did PCR using my treated plant gDNA using the following primers and obtained clear bands. I cloned and sequenced and saw there are no C to T conversions! But the mystery to me is that the universal methylated control I used in conjunction with Methylation-Gold Kit seems to be showing the conversion.

Promoter region of my gene:
AAGGCGATATTTGGTGAAAAAGAATGGTACTTCTTTAGTCCTAGAGACCGTAAGTACCCAAATGGATCCCGACCCAATAGGGTTGCCGGGTCTGGGTATTGGAAGGCCA
CCGGTACTGATAAAATTATCACATCAGATGGACGTAAAGTAGGTATCAAGAAAGCTCTCGTCTTTTACATTGGCAAGGCCC
CAAAAGGAACCAAAACTAATTGGATCATGCATGAATACCGCCTTATTGAATCCTCTCGCAAACATGGAAGCACGAAGGTAC
CAACGAAAGAAATTCCACCTGCAGATTAATTTTAATTTGTTTTGATACGCCTCAATATTAATTAATGATTTTTGTTAATTT
TCTTTGTTGTTACAGTTGGACGAATGGGTATTGTGTCGGATTTATAAGAAGAAAT

Primers used
Forward: AAGGYGATATTTGGTGAAAAAGAATGGTA
Reverse: ATTTCTTCTTATAAATCCRACACAATACCCATTC

It would be very helpful if someone could help me with this. My question is as to why there is no C to T conversion. Is it possible that all Cs are methylated?

Thank you in advance! I'd appreciate any suggestion.

#2 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,165 posts
67
Excellent

Posted 17 February 2010 - 09:32 PM

There are two possibilities:

1. Your DNA was not converted.

2. The primer design appears to me to be bad because neither primer contains sufficient non-cpg 'C's, thus allowing no discrimination against non-converted DNA. This possibility is more likely.

#3 methdetector

methdetector

    member

  • Active Members
  • Pip
  • 11 posts
0
Neutral

Posted 22 February 2010 - 02:44 PM

Thank you very much for your reply. I really appreciate it.


There are two possibilities:

1. Your DNA was not converted.

2. The primer design appears to me to be bad because neither primer contains sufficient non-cpg 'C's, thus allowing no discrimination against non-converted DNA. This possibility is more likely.



#4 et2b

et2b

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 47 posts
3
Neutral

Posted 20 April 2010 - 05:05 AM

Test your primers also on genomic DNA, good BS specific primers dont give a product. And indeed BS primers should at least contain 3 non CpG "C" and for sequencing preferably no CpG sites in the primers.
best
et2b

#5 methylnick

methylnick

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 245 posts
4
Neutral

Posted 18 May 2010 - 06:12 PM

I agree with the others with regard to the primer design.

But also, plants have non-CpG methylation as well so how would you be able to tell that from non-conversion?

Nick




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.