Would anybody know any software or online tools that can give me a list of mature microRNAs with a common motif? In other words, if I search on a particular sequence (e.g. AUCCGU) I would like a list of all mature microRNAs that contain this sequence.
Many thanks.
0
Tool to search for motifs within microRNAs?
Started by Baars01, Jan 19 2010 02:34 AM
5 replies to this topic
#2
-
- Moderator
-
- 815 posts
Epigenetist
Posted 20 January 2010 - 04:55 PM
WebLoGo can do what you wanted. For example, i input the following miRs to find potential motif.
UGAGGUAGUAGGUUGUAUAGUU
UGAGGUAGUAGGUUGUGUGGUU
UGAGGUAGUAGGUUGUAUGGUU
AGAGGUAGUAGGUUGCAUAGUU
UGAGGUAGGAGGUUGUAUAGUU
UGAGGUAGUAGAUUGUAUAGUU
UAGCAGCACAUAAUGGUUUGUG
UAGCAGCACGUAAAUAUUGGCG
CAAAGUGCUUACAGUGCAGGUAG
UAAGGUGCAUCUAGUGCAGAUAG
But Weblogo requires all sequences to be equal length.
You can also use the MEME program http://meme.sdsc.edu...gi-bin/meme.cgi
UGAGGUAGUAGGUUGUAUAGUU
UGAGGUAGUAGGUUGUGUGGUU
UGAGGUAGUAGGUUGUAUGGUU
AGAGGUAGUAGGUUGCAUAGUU
UGAGGUAGGAGGUUGUAUAGUU
UGAGGUAGUAGAUUGUAUAGUU
UAGCAGCACAUAAUGGUUUGUG
UAGCAGCACGUAAAUAUUGGCG
CAAAGUGCUUACAGUGCAGGUAG
UAAGGUGCAUCUAGUGCAGAUAG
But Weblogo requires all sequences to be equal length.
You can also use the MEME program http://meme.sdsc.edu...gi-bin/meme.cgi
#3
-
- Active Members
-
- 123 posts
Veteran
Posted 21 January 2010 - 07:42 AM
Thanks Pcrman, that's a nice online resource.
Jon D. Moulton
Gene Tools, LLC
www.gene-tools.com
Gene Tools, LLC
www.gene-tools.com
#4
-
- Active Members
-
- 45 posts
Enthusiast
Posted 28 January 2010 - 08:00 AM
Thanks for the resource, but I have it figured out in Excel.
This simply involves retrieving all miRNA sequences from www.microrna.org and listing them in Excel. Using filters you can remove all non-human miRNAs. Using formulas the hexamer at the 3' end can be retrieved and subsequently matched with a defined sequence.
This simply involves retrieving all miRNA sequences from www.microrna.org and listing them in Excel. Using filters you can remove all non-human miRNAs. Using formulas the hexamer at the 3' end can be retrieved and subsequently matched with a defined sequence.
Edited by Baars01, 28 January 2010 - 08:01 AM.
#5
-
- Active Members
-
- 7 posts
member
Posted 30 January 2010 - 10:39 PM
Baars01, on Jan 28 2010, 09:00 AM, said:
Thanks for the resource, but I have it figured out in Excel.
This simply involves retrieving all miRNA sequences from www.microrna.org and listing them in Excel. Using filters you can remove all non-human miRNAs. Using formulas the hexamer at the 3' end can be retrieved and subsequently matched with a defined sequence.
This simply involves retrieving all miRNA sequences from www.microrna.org and listing them in Excel. Using filters you can remove all non-human miRNAs. Using formulas the hexamer at the 3' end can be retrieved and subsequently matched with a defined sequence.
Can you give an example for your formula in excel, so we can get an idea how you do it?
#6
-
- Active Members
-
- 45 posts
Enthusiast
Posted 01 February 2010 - 04:14 AM
1. Download the entire microRNAome from www.microrna.org
2. Copy/Paste into Column A in Excel. You will have a column of sequences with above each sequence its FASTA name.
3. In Box B1 enter "=A2" (without "") and expand down to the end of the list. This will add the sequences next to their FASTA name.
4. Apply a filter to Column A and filter for anything containing "hsa". All human sequences will then be shown in Column B. Copy/Paste filtered Column A and B to a new sheet (Remember Paste Special -> Values only)
5. In box C1 of your new sheet input the following formula "=Right(B1,?)". Replace ? with the amount of bases you want to count up from the 3' end. Expand this to all rows.
You now have your desired sequence set in which a motif can be found using Ctrl+F
Alternatively, "=Left(B1,?)" can be used to single out sequences from the 5' end. A combination of both can give you desired sequences within the microRNA.
2. Copy/Paste into Column A in Excel. You will have a column of sequences with above each sequence its FASTA name.
3. In Box B1 enter "=A2" (without "") and expand down to the end of the list. This will add the sequences next to their FASTA name.
4. Apply a filter to Column A and filter for anything containing "hsa". All human sequences will then be shown in Column B. Copy/Paste filtered Column A and B to a new sheet (Remember Paste Special -> Values only)
5. In box C1 of your new sheet input the following formula "=Right(B1,?)". Replace ? with the amount of bases you want to count up from the 3' end. Expand this to all rows.
You now have your desired sequence set in which a motif can be found using Ctrl+F
Alternatively, "=Left(B1,?)" can be used to single out sequences from the 5' end. A combination of both can give you desired sequences within the microRNA.
