Jump to content


- - - - -

Luciferase GL4 siRNA


5 replies to this topic

#1 rimsky

    member

  • Active Members
  • Pip
  • 4 posts

Posted 06 January 2010 - 02:25 AM

I will use the B16-F10-luc2 (pGL4 luc2 Lentivirus) cell line for in vivo imaging to study the siRNA delivery using new vectors. So I would like to knock down the luciferase signal. Do you know if commercial siRNA are available for the pGL4 promoter (I can’t find anything in the literature) or is the Luciferase GL3 siRNA will work?



Thank you for your help,

Regards,

R

#2 KevinK

    Enthusiast

  • Active Members
  • PipPip
  • 54 posts

Posted 06 January 2010 - 07:44 AM

Dear Rimsky,
The siRNAs directed against the luc+ gene found in pGL3 will not likely work well for the luc2 gene in pGL4. We have tested a number of sequences in house here at Promega and found the following duplex to work the best of those tested, giving 80-90% knockdown;
GGACGAGGACGAGCACUUCUU

UUCCUGCUCCUGCUCGUGAAG

We hope to publish this on our website in the near future. Please let me know if you ahve any additional questions, and always feel free to contact Promega Technical Services.

Kind Regards,
Kevin
Promega Corporation
Madison, WI

#3 rimsky

    member

  • Active Members
  • Pip
  • 4 posts

Posted 06 January 2010 - 08:41 AM

Dear Kevin,

Thanks for your reply. Is this duplex available?

Kind regards,

Ludovic

View PostKevinK, on Jan 6 2010, 03:44 PM, said:

Dear Rimsky,
The siRNAs directed against the luc+ gene found in pGL3 will not likely work well for the luc2 gene in pGL4. We have tested a number of sequences in house here at Promega and found the following duplex to work the best of those tested, giving 80-90% knockdown;
GGACGAGGACGAGCACUUCUU

UUCCUGCUCCUGCUCGUGAAG

We hope to publish this on our website in the near future. Please let me know if you ahve any additional questions, and always feel free to contact Promega Technical Services.

Kind Regards,
Kevin


#4 rimsky

    member

  • Active Members
  • Pip
  • 4 posts

Posted 22 January 2010 - 06:48 AM

Dear Kevin,
I would like to know if you have a protocol that you can give me for the transfection of this cell line (Did you used any transfectant?)?

Thanks,
Regards,

R


View Postrimsky, on Jan 6 2010, 04:41 PM, said:

Dear Kevin,

Thanks for your reply. Is this duplex available?

Kind regards,

Ludovic

View PostKevinK, on Jan 6 2010, 03:44 PM, said:

Dear Rimsky,
The siRNAs directed against the luc+ gene found in pGL3 will not likely work well for the luc2 gene in pGL4. We have tested a number of sequences in house here at Promega and found the following duplex to work the best of those tested, giving 80-90% knockdown;
GGACGAGGACGAGCACUUCUU

UUCCUGCUCCUGCUCGUGAAG

We hope to publish this on our website in the near future. Please let me know if you ahve any additional questions, and always feel free to contact Promega Technical Services.

Kind Regards,
Kevin



#5 KevinK

    Enthusiast

  • Active Members
  • PipPip
  • 54 posts

Posted 22 January 2010 - 09:37 AM

Rimsky,
Our work in finding the siRNA sequence was in HEKs93 cells. I am getting the details of the transfection for you, but these will liley not be the same conditions needed for your B16-F10 cell line. Do you need a plasmid transfected or the siRNA? My understanding from your first post was that you were studying siRNA delivery. Are these oligos or plasmid driven?

Thanks,
Kevin
Promega Corporation
Madison, WI

#6 rimsky

    member

  • Active Members
  • Pip
  • 4 posts

Posted 28 January 2010 - 03:31 AM

Kevin,
Sorry for my late reply. I will used oligos.

Thanks for your help.

Rimsky

View PostKevinK, on Jan 22 2010, 05:37 PM, said:

Rimsky,
Our work in finding the siRNA sequence was in HEKs93 cells. I am getting the details of the transfection for you, but these will liley not be the same conditions needed for your B16-F10 cell line. Do you need a plasmid transfected or the siRNA? My understanding from your first post was that you were studying siRNA delivery. Are these oligos or plasmid driven?

Thanks,
Kevin






Home - About - Terms of Service - Privacy - Contact Us

©1999-2011 Protocol Online, All rights reserved.