Jump to content


- - - - -

trouble amplifying 2.5kb product from genomic DNA


3 replies to this topic

#1 ULBird

    member

  • Members
  • Pip
  • 3 posts

Posted 05 January 2010 - 10:52 AM

Hi all,

I am studying the effects of a mutation located in the poly(A) signal in the 3UTR of my favorite gene. I believe that this mutation will result in a longer 3UTR since the polyadenylation complex should continue along the message until a functional poly(A) signal is encountered. I have already successfully cloned the mutated 3UTR into an expression vector and now I intend to add additional downstream DNA (up to the next poly(A) signal) to this vector to test my hypothesis.

I am attempting to amplify this 2500bp region from genomic DNA extracted from HEK293T cells while introducing a 5' SacII restriction site. Thus far I have only gotten non-specific smearing which tends to "fade" with increasing Tm and decreasing annealing times and no band of interest. I am using ~200ng DNA template and Phusion polymerase. I have double-checked the primers and they seem fine. The Tm of both are 61c WITHOUT the SacII portion of forward primer.

I have two questions. First, the introduction of SacII (CCGCGG) to the forward primer significantly increases the Tm of the primer. I am disregarding this increase during the PCR reaction. Is this a potential cause of my problem?

Second, XbaI cuts a region of this genomic DNA that should give a 5100bp product that encompasses the target sites of my primers. Methylation sensitivity of XbaI aside, would it be a good idea to cut with this enzyme, run the DNA on a gel and purify the 5100bp band to use as a template for PCR?

Thanks in advance for any suggestions you may have.

#2 pDNA

    Veteran

  • Active Members
  • PipPipPipPipPip
  • 457 posts

Posted 05 January 2010 - 11:38 AM

maybe you can provide the whole sequence of your primer?

Could be due to a hairpin caused by the SacII-overhang? ...did you included some extra-basepairs after the restriction site?

I would suggest to do a nested PCR, this will decrease the smear!

Regards,
p

#3 ULBird

    member

  • Members
  • Pip
  • 3 posts

Posted 05 January 2010 - 11:55 AM

View PostpDNA, on Jan 5 2010, 02:38 PM, said:

maybe you can provide the whole sequence of your primer?

Could be due to a hairpin caused by the SacII-overhang? ...did you included some extra-basepairs after the restriction site?

I would suggest to do a nested PCR, this will decrease the smear!

Regards,
p


F CCGCGGAACGCCAGTGCAGGCTACTG
R TGTGCTGTGTGCTGGGATTACAGG

these primers should amplify a region directly downstream of TP53 3UTR

ACCGCCAGT is the sequence beginning directly after UTR, so I did not include extra basepairs.

I am currently titrating Mg2+ concentration in two different buffers to see if that helps.

#4 pDNA

    Veteran

  • Active Members
  • PipPipPipPipPip
  • 457 posts

Posted 06 January 2010 - 12:49 AM

you will need at least 3 bp after the SacII RE-site for the enzyme to work!!!

Watch the technical references at NEB.

So will run into serious problems when cloning this fragment!

Regards,
p





Home - About - Terms of Service - Privacy - Contact Us

©1999-2011 Protocol Online, All rights reserved.