Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Insertion Mutation in Insert Sequence


  • Please log in to reply
2 replies to this topic

#1 jason0429

jason0429

    member

  • Active Members
  • Pip
  • 15 posts
0
Neutral

Posted 04 January 2010 - 01:32 AM

Hi everyone,

I tried to clone my insert into pET15b and i managed to clone my insert into it. But when i sequence my clone there is an additional 7bp in my insert. This additional sequence is in my insert sequence. Why is there an additional sequence in my insert??? The insert is from pGEM, i clone my insert into pGEM then digest them and ligate into pET vector. All my insert sequence are inside my clones, but there are an additional 7bp in the sequence which is not meant to be there. This clones are in DH5alpha. My insert size is 924bp. The insert sequence in pGEM has not problem at all, the sequence has no extra 7bp in it.

correct insert sequence: GATCTGATGGTGGCTATGGGCTATGGCGGCAATCATGAGGATGCGGC

clone insert sequence : GATCTGATGGTGGCTATGGGCTATGGGCTATGGCGGCAATCATGAGGATGCGGC

GATCTGATGGTGGCTATGGGCTATGGGCTATGGCGGCAATCATGAGGATGCGGC
GATCTGATGGTGGCTATGGGCTATGG------------CGGCAATCATGAGGATGCGGC

Why is there an additional GCTATGG in my clone insert?? Could it be due to Slipped Strand Mispairing??

Thanks for reading my problem.

#2 scolix

scolix

    a student

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 314 posts
5
Neutral

Posted 27 February 2010 - 01:51 PM

try other cell strains which prevent recombinations. or check many other clones.

#3 HomeBrew

HomeBrew

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 930 posts
15
Good

Posted 28 February 2010 - 02:29 AM

How did you originally acquire the insert you cloned into pGEM that (if I understand correctly) you re-cloned into pET15b? Where on your insert is the additional 7 bp? Do these extra 7 bp exist in your pGEM insert?




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.