Hi everyone,
I tried to clone my insert into pET15b and i managed to clone my insert into it. But when i sequence my clone there is an additional 7bp in my insert. This additional sequence is in my insert sequence. Why is there an additional sequence in my insert??? The insert is from pGEM, i clone my insert into pGEM then digest them and ligate into pET vector. All my insert sequence are inside my clones, but there are an additional 7bp in the sequence which is not meant to be there. This clones are in DH5alpha. My insert size is 924bp. The insert sequence in pGEM has not problem at all, the sequence has no extra 7bp in it.
correct insert sequence: GATCTGATGGTGGCTATGGGCTATGGCGGCAATCATGAGGATGCGGC
clone insert sequence : GATCTGATGGTGGCTATGGGCTATGGGCTATGGCGGCAATCATGAGGATGCGGC
GATCTGATGGTGGCTATGGGCTATGGGCTATGGCGGCAATCATGAGGATGCGGC
GATCTGATGGTGGCTATGGGCTATGG------------CGGCAATCATGAGGATGCGGC
Why is there an additional GCTATGG in my clone insert?? Could it be due to Slipped Strand Mispairing??
Thanks for reading my problem.
Insertion Mutation in Insert Sequence
Started by jason0429, Jan 04 2010 01:32 AM
2 replies to this topic
#1
Posted 04 January 2010 - 01:32 AM
#2
Posted 27 February 2010 - 01:51 PM
try other cell strains which prevent recombinations. or check many other clones.
#3
Posted 28 February 2010 - 02:29 AM
How did you originally acquire the insert you cloned into pGEM that (if I understand correctly) you re-cloned into pET15b? Where on your insert is the additional 7 bp? Do these extra 7 bp exist in your pGEM insert?













