Site-directed mutagenesis (repeat oligo insert)
#1
Posted 22 December 2009 - 08:25 AM
I recently performed a site-directed mutagenesis reaction do introduce a BsrGI restriction site into my gene with the standard Stratagene kit.
oligo + GGGCATCACTTTCTTCTGTACAAAGGACGAGACCACCG
oligo - CGGTGGTCTCGTCCTTTGTACAGAAGAAAGTGATGCCC
It produced plenty of colonies, of which I mini-preped and digested 5 preparations.
I then ran these on a gel, the undigested were as to be expected whereas the digested gave a funny digestion pattern. After initially putting this down to sub-optimal digestion conditions I decided to send them off for sequencing just to check, I sequenced the sense strand only.
When they came back, to my disbelief, the mutagenesis oligos has managed to concatenate (3 oligos were found side by side) and insert themselves into the plasmid resulting in 3 restriction sites.
This has really puzzled me!
1) How on earth can this happen, I have the correct sequence for my gene right up to the introduction of the site and after the 3rd oligo the sequence is correct. How on earth can my oligos stick to each other, then anneal to the original vector, then create a viable plasmid???!!! I know this happens when you have oligos with complementary ends in ligation reactions, but surely this can't happen in SDM with only the polymerase enzyme???
2) I've had a scratch of my head and I *think* I should be able to use this plasmid to do what I want regardless of the extra insertions. The three introduced restriction sites are still viable and spaced out sufficiently therefore when I cut with BsrGI it should cut at all three sites and leave me with what I originally wanted (the vector with 3' GTAC overhangs for my insert). However, I have only sequenced the sense strand, any ideas if this would have been replicated on both strands.
Any thoughts would be welcome, I've never experienced this using SDM before, anyone out there experienced anything similar?
#2
Posted 27 December 2009 - 10:16 AM
scislave, on Dec 22 2009, 07:25 PM, said:
I recently performed a site-directed mutagenesis reaction do introduce a BsrGI restriction site into my gene with the standard Stratagene kit.
oligo + GGGCATCACTTTCTTCTGTACAAAGGACGAGACCACCG
oligo - CGGTGGTCTCGTCCTTTGTACAGAAGAAAGTGATGCCC
It produced plenty of colonies, of which I mini-preped and digested 5 preparations.
I then ran these on a gel, the undigested were as to be expected whereas the digested gave a funny digestion pattern. After initially putting this down to sub-optimal digestion conditions I decided to send them off for sequencing just to check, I sequenced the sense strand only.
When they came back, to my disbelief, the mutagenesis oligos has managed to concatenate (3 oligos were found side by side) and insert themselves into the plasmid resulting in 3 restriction sites.
This has really puzzled me!
1) How on earth can this happen, I have the correct sequence for my gene right up to the introduction of the site and after the 3rd oligo the sequence is correct. How on earth can my oligos stick to each other, then anneal to the original vector, then create a viable plasmid???!!! I know this happens when you have oligos with complementary ends in ligation reactions, but surely this can't happen in SDM with only the polymerase enzyme???
2) I've had a scratch of my head and I *think* I should be able to use this plasmid to do what I want regardless of the extra insertions. The three introduced restriction sites are still viable and spaced out sufficiently therefore when I cut with BsrGI it should cut at all three sites and leave me with what I originally wanted (the vector with 3' GTAC overhangs for my insert). However, I have only sequenced the sense strand, any ideas if this would have been replicated on both strands.
Any thoughts would be welcome, I've never experienced this using SDM before, anyone out there experienced anything similar?
Hi,
I just had the same thing happen, with only one repeat. Apparently, this is a known phenomenon when using quickchange SDM (see this post from 1996! http://www.bio.net/bionet/mm/methods/1996-...ber/051394.html ), although I haven't been able to figure out why either. my tandem repeat plasmid was useless, and I had to re-clone. I used a modification of the method whereby each of the primers has its own reaction tube, and they are mixed prior to DpnI treatment. This is supposed to eliminate the tandem repeat issue. I'll have results tuesday, crossing my fingers in the meantime...
Edited by beenyg, 27 December 2009 - 10:38 AM.
#3
Posted 04 January 2010 - 06:11 AM
beenyg, on Dec 27 2009, 06:16 PM, said:
scislave, on Dec 22 2009, 07:25 PM, said:
I recently performed a site-directed mutagenesis reaction do introduce a BsrGI restriction site into my gene with the standard Stratagene kit.
oligo + GGGCATCACTTTCTTCTGTACAAAGGACGAGACCACCG
oligo - CGGTGGTCTCGTCCTTTGTACAGAAGAAAGTGATGCCC
It produced plenty of colonies, of which I mini-preped and digested 5 preparations.
I then ran these on a gel, the undigested were as to be expected whereas the digested gave a funny digestion pattern. After initially putting this down to sub-optimal digestion conditions I decided to send them off for sequencing just to check, I sequenced the sense strand only.
When they came back, to my disbelief, the mutagenesis oligos has managed to concatenate (3 oligos were found side by side) and insert themselves into the plasmid resulting in 3 restriction sites.
This has really puzzled me!
1) How on earth can this happen, I have the correct sequence for my gene right up to the introduction of the site and after the 3rd oligo the sequence is correct. How on earth can my oligos stick to each other, then anneal to the original vector, then create a viable plasmid???!!! I know this happens when you have oligos with complementary ends in ligation reactions, but surely this can't happen in SDM with only the polymerase enzyme???
2) I've had a scratch of my head and I *think* I should be able to use this plasmid to do what I want regardless of the extra insertions. The three introduced restriction sites are still viable and spaced out sufficiently therefore when I cut with BsrGI it should cut at all three sites and leave me with what I originally wanted (the vector with 3' GTAC overhangs for my insert). However, I have only sequenced the sense strand, any ideas if this would have been replicated on both strands.
Any thoughts would be welcome, I've never experienced this using SDM before, anyone out there experienced anything similar?
Hi,
I just had the same thing happen, with only one repeat. Apparently, this is a known phenomenon when using quickchange SDM (see this post from 1996! http://www.bio.net/bionet/mm/methods/1996-...ber/051394.html ), although I haven't been able to figure out why either. my tandem repeat plasmid was useless, and I had to re-clone. I used a modification of the method whereby each of the primers has its own reaction tube, and they are mixed prior to DpnI treatment. This is supposed to eliminate the tandem repeat issue. I'll have results tuesday, crossing my fingers in the meantime...
Fingers crossed for you!
Haven't been able to work out how that happened, so I started again and sequenced a few colonies rather than one, ho-hum!
#4
Posted 23 February 2010 - 04:19 PM
We had 12(possibly more) repeats in one miniprep sample, and 3 in another one. =(
#5
Posted 23 February 2010 - 09:18 PM
beenyg, on Dec 27 2009, 07:16 PM, said:
Hi there!
beenyg, could you explain that modification of the method? How you manage to use just one primer in each reaction?
"This is SPARTA!"
"I´m the goddamn batman"
#7
Posted 26 February 2010 - 12:02 AM
#8
Posted 26 February 2010 - 09:00 AM
#9
Posted 26 February 2010 - 09:59 AM
#10
Posted 11 June 2010 - 04:03 AM
However with the higher amplification temperature of Phusion it may be possible that when the plasmid is fully replicated the 5' end of the new strand (your forward primer) might become displaced (by the polymerase or maybe on its own). If this were to happen the product could be created with a complementary region at each end. This strand then WOULD be able to be amplified exponentially and would dominate later cycles of the pcr. Multiple insertions could occur in a similar way.
I don't know if this is possible, but it's the explanation I have told myself. I don't think this counts as recombination so that suggestion from someone might be different and more accurate. If anyone is with me, then I would recommend making sure the 5' region of your primer has a few consecutive C/Gs to try and limit this (I have not tried this).
One suggestion was to do separate PCRs for each primer which would work, because as I said your product grows linearly so you would not lose any yield. If you halve volumes too, the only extra cost would be 1 pcr tube and 2 pipette tips for the same result with no inserts! I think I'll do this in future.
#11
Posted 16 April 2012 - 09:03 PM













