Hi everyone!!
Could you help me with knowing if this sequence (GGATACAGATACAGATACAA) ca be used as a good negative control for shRNA experiments in mouse???
Thank you!!!
shRNA negative control
Started by yarince, Dec 02 2009 08:43 AM
2 replies to this topic
#1
Posted 02 December 2009 - 08:43 AM
#2
Posted 02 December 2009 - 03:49 PM
This control is not very good but still usable because it has significant homology with other mRNA sequences. Below are the BLAST results against mouse refSeq.
ref|NM_019658.5| UniGene infoGeoGene info Mus musculus soc-2 (suppressor of clear) homolog (C. elegans) (Shoc2), mRNA Length=3964 GENE ID: 56392 Shoc2 | soc-2 (suppressor of clear) homolog (C. elegans) [Mus musculus] (Over 10 PubMed links) Score = 30.1 bits (32), Expect = 0.24 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 2 GATACAGATACAGATA 17 |||||||||||||||| Sbjct 2180 GATACAGATACAGATA 2165 Score = 28.3 bits (30), Expect = 0.85 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 5 ACAGATACAGATACA 19 ||||||||||||||| Sbjct 2183 ACAGATACAGATACA 2169 >ref|NM_145436.2| UniGene infoGeoGene info Mus musculus cell division cycle 27 homolog (S. cerevisiae) (Cdc27), mRNA Length=5783 GENE ID: 217232 Cdc27 | cell division cycle 27 homolog (S. cerevisiae) [Mus musculus] (Over 10 PubMed links) Score = 30.1 bits (32), Expect = 0.24 Identities = 18/19 (94%), Gaps = 0/19 (0%) Strand=Plus/Plus Query 1 GGATACAGATACAGATACA 19 ||| ||||||||||||||| Sbjct 4992 GGACACAGATACAGATACA 5010 >ref|NM_001043355.2| UniGene infoGene info Mus musculus microtubule-associated protein 6 (Mtap6), transcript variant 3, mRNA Length=2335 GENE ID: 17760 Mtap6 | microtubule-associated protein 6 [Mus musculus] (Over 10 PubMed links) Score = 30.1 bits (32), Expect = 0.24 Identities = 18/19 (94%), Gaps = 0/19 (0%) Strand=Plus/Plus Query 2 GATACAGATACAGATACAA 20 ||||||| ||||||||||| Sbjct 1796 GATACAGGTACAGATACAA 1814 >ref|NM_010837.3| UniGene infoGeoGene info Mus musculus microtubule-associated protein 6 (Mtap6), transcript variant 1, mRNA Length=3447 GENE ID: 17760 Mtap6 | microtubule-associated protein 6 [Mus musculus] (Over 10 PubMed links) Score = 30.1 bits (32), Expect = 0.24 Identities = 18/19 (94%), Gaps = 0/19 (0%) Strand=Plus/Plus Query 2 GATACAGATACAGATACAA 20 ||||||| ||||||||||| Sbjct 2892 GATACAGGTACAGATACAA 2910 >ref|NM_001163333.1| UniGene infoGene info Mus musculus CTTNBP2 N-terminal like (Cttnbp2nl), transcript variant 3, mRNA Length=4830 GENE ID: 80281 Cttnbp2nl | CTTNBP2 N-terminal like [Mus musculus] (Over 10 PubMed links) Score = 28.3 bits (30), Expect = 0.85 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 3 ATACAGATACAGATA 17 ||||||||||||||| Sbjct 3076 ATACAGATACAGATA 3062 >ref|NM_001163332.1| UniGene infoGene info Mus musculus CTTNBP2 N-terminal like (Cttnbp2nl), transcript variant 2, mRNA Length=4838 GENE ID: 80281 Cttnbp2nl | CTTNBP2 N-terminal like [Mus musculus] (Over 10 PubMed links) Score = 28.3 bits (30), Expect = 0.85 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 3 ATACAGATACAGATA 17 ||||||||||||||| Sbjct 3084 ATACAGATACAGATA 3070 >ref|NM_030249.4| UniGene infoGene info Mus musculus CTTNBP2 N-terminal like (Cttnbp2nl), transcript variant 1, mRNA Length=4946 GENE ID: 80281 Cttnbp2nl | CTTNBP2 N-terminal like [Mus musculus] (Over 10 PubMed links) Score = 28.3 bits (30), Expect = 0.85 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 3 ATACAGATACAGATA 17 ||||||||||||||| Sbjct 3192 ATACAGATACAGATA 3178 >ref|NM_026605.2| UniGene infoGene info Mus musculus symplekin (Sympk), mRNA Length=4121 GENE ID: 68188 Sympk | symplekin [Mus musculus] (Over 10 PubMed links) Score = 28.3 bits (30), Expect = 0.85 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 6 CAGATACAGATACAA 20 ||||||||||||||| Sbjct 2534 CAGATACAGATACAA 2520 >ref|NM_001033380.3| UniGene infoGeoGene info Mus musculus inositol 1,4,5-triphosphate receptor interacting protein-like 2 (Itpripl2), mRNA Length=6891 GENE ID: 319622 Itpripl2 | inositol 1,4,5-triphosphate receptor interacting protein-like 2 [Mus musculus] (10 or fewer PubMed links) Score = 28.3 bits (30), Expect = 0.85 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 5 ACAGATACAGATACA 19 ||||||||||||||| Sbjct 4165 ACAGATACAGATACA 4151 >ref|NR_003549.1| Gene infoDownload subject sequence spanning the HSP Mus musculus RIKEN cDNA 3110048L19 gene (3110048L19Rik), non-coding RNA Length=33831 GENE ID: 73233 3110048L19Rik | zinc finger pseudogene [Mus musculus] (Over 10 PubMed links) Score = 26.5 bits (28), Expect = 3.0 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 2 GATACAGATACAGATAC 18 || |||||||||||||| Sbjct 10503 GAGACAGATACAGATAC 10487 >ref|NM_022814.2| UniGene infoGeoGene infoDownload subject sequence spanning the HSP Mus musculus sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1 (Svep1), mRNA Length=11275 GENE ID: 64817 Svep1 | sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1 [Mus musculus] (Over 10 PubMed links) Score = 26.5 bits (28), Expect = 3.0 Identities = 17/19 (89%), Gaps = 0/19 (0%) Strand=Plus/Plus Query 1 GGATACAGATACAGATACA 19 |||| | |||||||||||| Sbjct 9670 GGATTCGGATACAGATACA 9688 >ref|NM_009390.2| UniGene infoGeoGene info Mus musculus tolloid-like (Tll1), mRNA Length=4928 GENE ID: 21892 Tll1 | tolloid-like [Mus musculus] (Over 10 PubMed links) Score = 26.5 bits (28), Expect = 3.0 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 7 AGATACAGATACAA 20 |||||||||||||| Sbjct 4336 AGATACAGATACAA 4323 >ref|NM_130877.2| UniGene infoGeoGene info Mus musculus paternally expressed 10 (Peg10), transcript variant 1, mRNA Length=6677 GENE ID: 170676 Peg10 | paternally expressed 10 [Mus musculus] (Over 10 PubMed links) Score = 26.5 bits (28), Expect = 3.0 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 2 GATACAGATACAGATAC 18 ||||| ||||||||||| Sbjct 2341 GATACTGATACAGATAC 2325 >ref|NM_001040611.1| UniGene infoGeoGene info Mus musculus paternally expressed 10 (Peg10), transcript variant 1, mRNA Length=6677 GENE ID: 170676 Peg10 | paternally expressed 10 [Mus musculus] (Over 10 PubMed links) Score = 26.5 bits (28), Expect = 3.0 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 2 GATACAGATACAGATAC 18 ||||| ||||||||||| Sbjct 2341 GATACTGATACAGATAC 2325 >ref|NM_178045.3| UniGene infoGeoGene info Mus musculus Ras association (RalGDS/AF-6) domain family member 4 (Rassf4), mRNA Length=6325 GENE ID: 213391 Rassf4 | Ras association (RalGDS/AF-6) domain family member 4 [Mus musculus] (Over 10 PubMed links) Score = 26.5 bits (28), Expect = 3.0 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 2 GATACAGATACAGA 15 |||||||||||||| Sbjct 1996 GATACAGATACAGA 2009
#3
Posted 03 December 2009 - 09:07 AM
Thank you very much!
Then, How could I design a good negative control for mouse?? Do you know some database where I could find it???
Then, How could I design a good negative control for mouse?? Do you know some database where I could find it???













