Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!

shRNA negative control

  • Please log in to reply
2 replies to this topic

#1 yarince



  • Active Members
  • Pip
  • 5 posts

Posted 02 December 2009 - 08:43 AM

Hi everyone!!

Could you help me with knowing if this sequence (GGATACAGATACAGATACAA) ca be used as a good negative control for shRNA experiments in mouse???
Thank you!!!

#2 pcrman



  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,165 posts

Posted 02 December 2009 - 03:49 PM

This control is not very good but still usable because it has significant homology with other mRNA sequences. Below are the BLAST results against mouse refSeq.

ref|NM_019658.5| UniGene infoGeoGene info Mus musculus soc-2 (suppressor of clear) homolog (C. elegans) 
(Shoc2), mRNA

 GENE ID: 56392 Shoc2 | soc-2 (suppressor of clear) homolog (C. elegans)
[Mus musculus] (Over 10 PubMed links)

 Score = 30.1 bits (32),  Expect = 0.24
 Identities = 16/16 (100%), Gaps = 0/16 (0%)

Sbjct  2180  GATACAGATACAGATA  2165

 Score = 28.3 bits (30),  Expect = 0.85
 Identities = 15/15 (100%), Gaps = 0/15 (0%)

Sbjct  2183  ACAGATACAGATACA  2169

>ref|NM_145436.2| UniGene infoGeoGene info Mus musculus cell division cycle 27 homolog (S. cerevisiae) (Cdc27), 

 GENE ID: 217232 Cdc27 | cell division cycle 27 homolog (S. cerevisiae)
[Mus musculus] (Over 10 PubMed links)

 Score = 30.1 bits (32),  Expect = 0.24
 Identities = 18/19 (94%), Gaps = 0/19 (0%)

			 ||| |||||||||||||||

>ref|NM_001043355.2| UniGene infoGene info Mus musculus microtubule-associated protein 6 (Mtap6), transcript 
variant 3, mRNA

 GENE ID: 17760 Mtap6 | microtubule-associated protein 6 [Mus musculus]
(Over 10 PubMed links)

 Score = 30.1 bits (32),  Expect = 0.24
 Identities = 18/19 (94%), Gaps = 0/19 (0%)

			 ||||||| |||||||||||

>ref|NM_010837.3| UniGene infoGeoGene info Mus musculus microtubule-associated protein 6 (Mtap6), transcript 
variant 1, mRNA

 GENE ID: 17760 Mtap6 | microtubule-associated protein 6 [Mus musculus]
(Over 10 PubMed links)

 Score = 30.1 bits (32),  Expect = 0.24
 Identities = 18/19 (94%), Gaps = 0/19 (0%)

			 ||||||| |||||||||||

>ref|NM_001163333.1| UniGene infoGene info Mus musculus CTTNBP2 N-terminal like (Cttnbp2nl), transcript 
variant 3, mRNA

 GENE ID: 80281 Cttnbp2nl | CTTNBP2 N-terminal like [Mus musculus]
(Over 10 PubMed links)

 Score = 28.3 bits (30),  Expect = 0.85
 Identities = 15/15 (100%), Gaps = 0/15 (0%)

Sbjct  3076  ATACAGATACAGATA  3062

>ref|NM_001163332.1| UniGene infoGene info Mus musculus CTTNBP2 N-terminal like (Cttnbp2nl), transcript 
variant 2, mRNA

 GENE ID: 80281 Cttnbp2nl | CTTNBP2 N-terminal like [Mus musculus]
(Over 10 PubMed links)

 Score = 28.3 bits (30),  Expect = 0.85
 Identities = 15/15 (100%), Gaps = 0/15 (0%)

Sbjct  3084  ATACAGATACAGATA  3070

>ref|NM_030249.4| UniGene infoGene info Mus musculus CTTNBP2 N-terminal like (Cttnbp2nl), transcript 
variant 1, mRNA

 GENE ID: 80281 Cttnbp2nl | CTTNBP2 N-terminal like [Mus musculus]
(Over 10 PubMed links)

 Score = 28.3 bits (30),  Expect = 0.85
 Identities = 15/15 (100%), Gaps = 0/15 (0%)

Sbjct  3192  ATACAGATACAGATA  3178

>ref|NM_026605.2| UniGene infoGene info Mus musculus symplekin (Sympk), mRNA

 GENE ID: 68188 Sympk | symplekin [Mus musculus] (Over 10 PubMed links)

 Score = 28.3 bits (30),  Expect = 0.85
 Identities = 15/15 (100%), Gaps = 0/15 (0%)

Sbjct  2534  CAGATACAGATACAA  2520

>ref|NM_001033380.3| UniGene infoGeoGene info Mus musculus inositol 1,4,5-triphosphate receptor interacting 
protein-like 2 (Itpripl2), mRNA

 GENE ID: 319622 Itpripl2 | inositol 1,4,5-triphosphate receptor interacting
protein-like 2 [Mus musculus] (10 or fewer PubMed links)

 Score = 28.3 bits (30),  Expect = 0.85
 Identities = 15/15 (100%), Gaps = 0/15 (0%)

Sbjct  4165  ACAGATACAGATACA  4151

>ref|NR_003549.1| Gene infoDownload subject sequence spanning the									HSP Mus musculus RIKEN cDNA 3110048L19 gene (3110048L19Rik), non-coding 

 GENE ID: 73233 3110048L19Rik | zinc finger pseudogene [Mus musculus]
(Over 10 PubMed links)

 Score = 26.5 bits (28),  Expect = 3.0
 Identities = 16/17 (94%), Gaps = 0/17 (0%)

			  || ||||||||||||||
Sbjct  10503  GAGACAGATACAGATAC  10487

>ref|NM_022814.2| UniGene infoGeoGene infoDownload subject sequence spanning the									HSP Mus musculus sushi, von Willebrand factor type A, EGF and pentraxin 
domain containing 1 (Svep1), mRNA

 GENE ID: 64817 Svep1 | sushi, von Willebrand factor type A, EGF and pentraxin
domain containing 1 [Mus musculus] (Over 10 PubMed links)

 Score = 26.5 bits (28),  Expect = 3.0
 Identities = 17/19 (89%), Gaps = 0/19 (0%)

			 |||| | ||||||||||||

>ref|NM_009390.2| UniGene infoGeoGene info Mus musculus tolloid-like (Tll1), mRNA

 GENE ID: 21892 Tll1 | tolloid-like [Mus musculus] (Over 10 PubMed links)

 Score = 26.5 bits (28),  Expect = 3.0
 Identities = 14/14 (100%), Gaps = 0/14 (0%)

Sbjct  4336  AGATACAGATACAA  4323

>ref|NM_130877.2| UniGene infoGeoGene info Mus musculus paternally expressed 10 (Peg10), transcript variant 
1, mRNA

 GENE ID: 170676 Peg10 | paternally expressed 10 [Mus musculus]
(Over 10 PubMed links)

 Score = 26.5 bits (28),  Expect = 3.0
 Identities = 16/17 (94%), Gaps = 0/17 (0%)

			 ||||| |||||||||||
Sbjct  2341  GATACTGATACAGATAC  2325

>ref|NM_001040611.1| UniGene infoGeoGene info Mus musculus paternally expressed 10 (Peg10), transcript variant 
1, mRNA

 GENE ID: 170676 Peg10 | paternally expressed 10 [Mus musculus]
(Over 10 PubMed links)

 Score = 26.5 bits (28),  Expect = 3.0
 Identities = 16/17 (94%), Gaps = 0/17 (0%)

			 ||||| |||||||||||
Sbjct  2341  GATACTGATACAGATAC  2325

>ref|NM_178045.3| UniGene infoGeoGene info Mus musculus Ras association (RalGDS/AF-6) domain family member 
4 (Rassf4), mRNA

 GENE ID: 213391 Rassf4 | Ras association (RalGDS/AF-6) domain family member 4
[Mus musculus] (Over 10 PubMed links)

 Score = 26.5 bits (28),  Expect = 3.0
 Identities = 14/14 (100%), Gaps = 0/14 (0%)

Sbjct  1996  GATACAGATACAGA  2009

#3 yarince



  • Active Members
  • Pip
  • 5 posts

Posted 03 December 2009 - 09:07 AM

Thank you very much!

Then, How could I design a good negative control for mouse?? Do you know some database where I could find it???

Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.