Jump to content


- - - - -

Interpreting melting curve data in Sybr Green RT-PCR


12 replies to this topic

#1 pop09

    Enthusiast

  • Active Members
  • PipPip
  • 20 posts

Posted 06 November 2009 - 08:26 PM

Hi, I have been using a real-time PCR protocol which was said to have been optimized previously by someone in the lab (who is gone now and I cannot contact). Because I am new with real time PCR, I followed this person's protocol and thought I am getting it right. But I have very specific questions about my data.

1. Is it normal to see only one distinct peak in the melting curve, but actually have several Tm values in the melt curve report? An example is shown below which I just copied and pasted from the machine's report:

Well Well Identifier Peak ID Melt Temp Beg. Temp End Temp

A1 sample1 A1.1 81.5 76.0 86
A1.2 74.0 69.5 75.5
A1.3 67.0 65.5 69
A1.4 62.0 59.5 64

2. I am also getting slightly different Tm values for the same PCR run, same species of the organism but different DNA samples. Example of the different Tms: 81.5, 81, 82.....Sometimes, I also get a Tm value of 81.5 for my no template control but the peak is only a slight bump on the melting curve with a Ct of >35. Does this mean I contaminated my negative control with my DNA?

Please help me iron out this mess.

Edited by pop09, 06 November 2009 - 08:27 PM.


#2 Prep!

    Am I me???!!!

  • Active Members
  • PipPipPipPipPip
  • 2,718 posts

Posted 06 November 2009 - 08:39 PM

1) getting more than one Ct valuesd means tere are more than one DNA sizes present in there.. may be primer dimers.. or non specific amplification along with your interest amplicon
2) 81 to 82 degrees is a 1 degree change.. see the instument validation report on how much difference in temp it can measure accurately and u l get the answer.. if its more than 1 or 1 then these three values can be counted as 1 (corect)
ya your negative control might be slightly contaminated. I have usually observed that the melt curve is not nevessarily in accordance with the same ratio of decreasing fluorescence as in the amplification curve... so even a value of 35 might give u some peak height in the melt curve
hope this helps..
conclusion: u might have to check if your primers are designed properly!!! not forgeeting the amplification parameters too!!
Support bacteria - They are the only culture some people have!!!
Cheers!!!

#3 pop09

    Enthusiast

  • Active Members
  • PipPip
  • 20 posts

Posted 06 November 2009 - 09:38 PM

Thank you for your response. When you say instrument validation report, which are you referring to?

#4 Prep!

    Am I me???!!!

  • Active Members
  • PipPipPipPipPip
  • 2,718 posts

Posted 06 November 2009 - 09:43 PM

Well normally when any instrument is installed.. they do a IQ (Instrumetn qualification) and OQ (Operational qualification). I am refering to this report. IF this is not done.. then teh variation of 1 degrees is like a very good result anyways!!! :D
Support bacteria - They are the only culture some people have!!!
Cheers!!!

#5 pop09

    Enthusiast

  • Active Members
  • PipPip
  • 20 posts

Posted 06 November 2009 - 09:44 PM

Hi I also checked the primers for hetero and homodimer formation using ITD DNA oligo analyzer. The dimer formation appears to be low. As I have said I am new with real time PCR and what I want to do is find out if the protocol I am using is really optimized. How should I begin?

#6 Prep!

    Am I me???!!!

  • Active Members
  • PipPipPipPipPip
  • 2,718 posts

Posted 06 November 2009 - 09:55 PM

View Postpop09, on Nov 7 2009, 11:14 AM, said:

Hi I also checked the primers for hetero and homodimer formation using ITD DNA oligo analyzer. The dimer formation appears to be low. As I have said I am new with real time PCR and what I want to do is find out if the protocol I am using is really optimized. How should I begin?


ya may be the primers are fine.. but as u say u need to check the protocol.. may be optimise it is all u might have to do.. why dont u run the protocol in a normal pcr and check for bands in teh gel.. if there are multiple.. try doing a gradient for teh annealing temp...
Support bacteria - They are the only culture some people have!!!
Cheers!!!

#7 Prep!

    Am I me???!!!

  • Active Members
  • PipPipPipPipPip
  • 2,718 posts

Posted 06 November 2009 - 09:57 PM

will be better if u can flood inmore details like the primer seq.. the protocol for amplification.. the curves tat u are talking about...
is the nmethod used as a positive negative thing.. or u are quantifying sumthing by a standard curve... etc etc
Support bacteria - They are the only culture some people have!!!
Cheers!!!

#8 pop09

    Enthusiast

  • Active Members
  • PipPip
  • 20 posts

Posted 07 November 2009 - 05:56 AM

I am looking at a SNP and relatively quantifying a mutant allele. I prepare two master mixes, with the same reverse primer, but different forward primers. The two forward primers have one nucleotide difference at the 3' end. I call these the wildtype forward and mutant forward primer. My reaction tube consists of 0.1 uM of each primers, 0.5X of a Sybr Green Mix, and 5 ul of my DNA. Total reaction vol is 25 ul. The RT-PCR run is attached as a report here.

The primer sequences are:

Mutant Allele : 5’- TACGGGAGATGAGCCTATGCGC -3’
Wild-type Allele: 5’- TACGGGCAGATGAGCCTATGCGG -3’
Common Reverse: 5’- ACCTACTTAAAGCTTTAGAAGTTTCC -3’


Thank you so much!

Attached File(s)



#9 Prep!

    Am I me???!!!

  • Active Members
  • PipPipPipPipPip
  • 2,718 posts

Posted 07 November 2009 - 08:37 PM

hey tere... i have not yet looked into the graph but i think 0.5X SYBR might be the roblem here... usually any reaction runs in a final conc of 1X.
In a hurry so cant interpret the file right now.. but wil get back to u... if possible upload any one ot two melt curve so tat it is clearly seen.... Also the primer aneealing tem,p seems too low to me unless it is well characterized.. tat is why i say u might have to modify the amplification arameters!!
Best luck!!!
Support bacteria - They are the only culture some people have!!!
Cheers!!!

#10 pop09

    Enthusiast

  • Active Members
  • PipPip
  • 20 posts

Posted 08 November 2009 - 04:54 PM

I look forward to your detailed comments on that one. Thank you. The annealing temp is 58C. I tried a 1x and a 0.5X before and thought I did not get any difference. Ok I will check this out again and hope you can give me more details. I have uploaded another file with the melt curve.

Attached File(s)



#11 Prep!

    Am I me???!!!

  • Active Members
  • PipPipPipPipPip
  • 2,718 posts

Posted 08 November 2009 - 10:13 PM

hi pop i saw the curves... i striongly feel that the amplification protocol needs to be worked on.. although tere may be different opinions too!!! 58 degrees seems to me too low a temperature for annealing given the GC content in your primers which may be the cause of many melt curves due to non-specific binding.. did u run a gel or this pcr product ever??!! do you get multiple species tere too?? in that case i suggest do a gradient for primer annealing and try running a gel till a single bnand of your interest and then u can switch back to real time!!
why i say 1X is that along with the sybr green, there are dNTP,s taqm etc present.. may be the 0.5X sybr green s not making a difference but the otehr components can!!!
Support bacteria - They are the only culture some people have!!!
Cheers!!!

#12 pop09

    Enthusiast

  • Active Members
  • PipPip
  • 20 posts

Posted 09 November 2009 - 05:34 AM

Thanks Pradeep. Yes I did a regular PCR (temp gradient 55, 58 and 60C). My results are:

1. At all temperatures, the positive samples amplified a single band at the same intensity. The band is <200 bp but >150bp. Is this ok?
So I intend to check annealing temp to higher than 60 in the regular PCR, then optimize in the real time PCR machine later.

2. I got very faint fuzzy band in the negative controls at all temperatures tested in regular PCR. The band size is less than my product above, but it is very close to 150 bp. I don't have these bands in my positive controls (unless the product because of its high concentration "masks" the fluorescence of this non-specific amplicon? is that possible?). primer dimers are only around 100 bp or less right?

I'll let you know at the end of hte day what I get for my regular PCR temp gradient analysis.

#13 pop09

    Enthusiast

  • Active Members
  • PipPip
  • 20 posts

Posted 11 November 2009 - 04:32 AM

Sorry for this delayed update. I ran a regular PCR at higher temps (58 62 66 70), and I got amplification only up to 62 (band is less intense of course than 58. Should I still try gradient between 58 and 62? what else should I consider when I start optimizing in real time machine? thanks again!





Home - About - Terms of Service - Privacy - Contact Us

©1999-2011 Protocol Online, All rights reserved.