4 replies to this topic

[kristian]

I am going to send my recombinant plasmid to a sequencing facility. I used pGEM Teasy vector which contains a T7 promoter. The form that I am filling up gives 2 options for T7 as sequencing primer namely T7 (AATACGACTCACTATAG) and T7 Promoter (TAATACGACTCACTATAGGG). These primers target the same site in the plasmid but vary a bit in length. Please help me choose which should I use.
Thanks!

[Quasimondo]

kristian, on Nov 5 2009, 11:36 AM, said:

I am going to send my recombinant plasmid to a sequencing facility. I used pGEM Teasy vector which contains a T7 promoter. The form that I am filling up gives 2 options for T7 as sequencing primer namely T7 (AATACGACTCACTATAG) and T7 Promoter (TAATACGACTCACTATAGGG). These primers target the same site in the plasmid but vary a bit in length. Please help me choose which should I use.
Thanks!

The longer the complementary sequence, the lower the chance you got the contaminated result, I think. So the longer sequence would be my choice

[jiajia1987]

I would choose T7 promoter as well.

[kristian]

Quasimondo, on Nov 5 2009, 02:25 PM, said:

kristian, on Nov 5 2009, 11:36 AM, said:

I am going to send my recombinant plasmid to a sequencing facility. I used pGEM Teasy vector which contains a T7 promoter. The form that I am filling up gives 2 options for T7 as sequencing primer namely T7 (AATACGACTCACTATAG) and T7 Promoter (TAATACGACTCACTATAGGG). These primers target the same site in the plasmid but vary a bit in length. Please help me choose which should I use.
Thanks!

The longer the complementary sequence, the lower the chance you got the contaminated result, I think. So the longer sequence would be my choice

Thanks for your help!

[kristian]

jiajia1987, on Nov 5 2009, 02:50 PM, said:

I would choose T7 promoter as well.

Thanks!