Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

sequencing primer: T7 or T7promoter?


  • Please log in to reply
4 replies to this topic

#1 kristian

kristian

    member

  • Active Members
  • Pip
  • 9 posts
0
Neutral

Posted 04 November 2009 - 06:36 PM

I am going to send my recombinant plasmid to a sequencing facility. I used pGEM Teasy vector which contains a T7 promoter. The form that I am filling up gives 2 options for T7 as sequencing primer namely T7 (AATACGACTCACTATAG) and T7 Promoter (TAATACGACTCACTATAGGG). These primers target the same site in the plasmid but vary a bit in length. Please help me choose which should I use.
Thanks!

#2 Qundo12

Qundo12

    E. coli farmer

  • Active Members
  • PipPipPipPipPip
  • 88 posts
2
Neutral

Posted 04 November 2009 - 10:25 PM

I am going to send my recombinant plasmid to a sequencing facility. I used pGEM Teasy vector which contains a T7 promoter. The form that I am filling up gives 2 options for T7 as sequencing primer namely T7 (AATACGACTCACTATAG) and T7 Promoter (TAATACGACTCACTATAGGG). These primers target the same site in the plasmid but vary a bit in length. Please help me choose which should I use.
Thanks!

The longer the complementary sequence, the lower the chance you got the contaminated result, I think. So the longer sequence would be my choice

#3 jiajia1987

jiajia1987

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 212 posts
0
Neutral

Posted 04 November 2009 - 10:50 PM

I would choose T7 promoter as well.

#4 kristian

kristian

    member

  • Active Members
  • Pip
  • 9 posts
0
Neutral

Posted 07 November 2009 - 12:13 AM

I am going to send my recombinant plasmid to a sequencing facility. I used pGEM Teasy vector which contains a T7 promoter. The form that I am filling up gives 2 options for T7 as sequencing primer namely T7 (AATACGACTCACTATAG) and T7 Promoter (TAATACGACTCACTATAGGG). These primers target the same site in the plasmid but vary a bit in length. Please help me choose which should I use.
Thanks!

The longer the complementary sequence, the lower the chance you got the contaminated result, I think. So the longer sequence would be my choice

Thanks for your help! :)

#5 kristian

kristian

    member

  • Active Members
  • Pip
  • 9 posts
0
Neutral

Posted 07 November 2009 - 12:14 AM

I would choose T7 promoter as well.

Thanks! :)




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.