5 replies to this topic

[laurequillo]

Hi everybody,

I have my protein of interest in pcDNA3 with Flag in the N terminus, and I want to create an untagged version of my protein. I designed some primers to amplify just my sequence,adding some restriction sites and introduce it in pcDNA3.
In order to do so, I added 5 bases (to allow the enzyme to cut), an EcoRI site and a kozak sequence in the Sense primer ( 17 extra bases, and 41 matched bases, 52% CG in total) and a HindIII site and 5 more bases in the Antisese oligo (11 extra bases and 43 matched bases,53% CG in total). Here my primers:

SENSE: 5´- GCAGAGCGAATTCCACCATGGCCTCACATGTGCAAGTTTTCTCCCCTCACACCCTTCAATC -3´
ANTISENSE: 5´- CCCTCAAGCTTTTATATGTAAGGGTACTGGTTGACCTTGGCGGGGCTCAGTGGG -3´

The Tm without the extra bases are about 84ºC


My protein is about 3600bp. My questions is:

Are those primers good enough to perform the pcr, and if so, how should I perform it? I was gonna do something like this:

98º 30sec
98º 10sec
55º 20sec
71º 60sec
Repeat steps 2-4 seven times

98º 10sec
75º 1min20sec
30 times

72 10 min

4ºC

Is this the best way to perform that kind of PCR??

Thanks a lot (I repeated this topic in the Molecular Biology forum because I was not sure where it fit better)

Edited by laurequillo, 27 October 2009 - 02:51 AM.

[badger]

Hello!

Your primers are too long, as the Tm is sky-high.
Since you'll be amplifying from a purified plasmid, there will be not much unspecific target around.
Try to shorten the specific sequence so that you have a maximum Tm of 70C

Try longer initial denaturation:
60 seconds

amplification cycles (temperatures for denaturation and elongation depend on the DNA polymerase you're using; check with your supplier's tech data sheet)
denaturation:95-98C 15-30 s (lower is better for the half-life of the DNA polymerase enzyme)
tm-5 (e.g.: Tm is 70, then go for 60-65 C) for 20-30 s; you can also try a gradient with varying temp.
elongation at 72C for 45-60s/kb (depends again on the enzyme; check data sheet)

final elongation (10 min at 72C): only necessary for TA-cloning and when you have a DNA pol which can do this!
Since you wanna use restriction enzymes for your product for subcloning, you don't need this step.

[laurequillo]

badger, on Nov 4 2009, 10:48 AM, said:

final elongation (10 min at 72C): only necessary for TA-cloning and when you have a DNA pol which can do this!
Since you wanna use restriction enzymes for your product for subcloning, you don't need this step.

Thanks a lot for your advices.

Regarding the final elongation; I think that step is for finishing any "uncomplete" fragment. So your point is that the final elongation is only necessary for TA cloning??

[Adrian K]

Usually the final elongation will add "a" overhang for TA cloning.

Since you are cloning 3.8kb, i suggest your PCR to be:

95º 3m; 95º 1m, Annealing temperature(xºC): 1m, 72º 3m x30 times; 72 6min, 4ºC

I used to clone 3.6kb fragments and the pcr condition i mentioned works fine with me. I use GoTaq From promega and add DMSO in my mastermix.
Since is a long PCR I suggest try find high fidelity Taq.

Hope this helps.

[laurequillo]

adrian kohsf, on Nov 4 2009, 12:25 PM, said:

Usually the final elongation will add "a" overhang for TA cloning.

Since you are cloning 3.8kb, i suggest your PCR to be:

95º 3m; 95º 1m, Annealing temperature(xºC): 1m, 72º 3m x30 times; 72 6min, 4ºC

I used to clone 3.6kb fragments and the pcr condition i mentioned works fine with me. I use GoTaq From promega and add DMSO in my mastermix.
Since is a long PCR I suggest try find high fidelity Taq.

Hope this helps.

Sure it helps!

I have Pfu and Expand high fidelity plus PCR system from roche. I will try first with the expand system.

[Adrian K]

Good luck and keep us update about your finding. All the best