Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

- - - - -

Designing primers for cloning


  • Please log in to reply
15 replies to this topic

#1 laurequillo

laurequillo

    The Goddamn Batman!

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 265 posts
1
Neutral

Posted 27 October 2009 - 01:58 AM

Hi everybody,

I have my protein of interest in pcDNA3 with Flag in the N terminus, and I want to create an untagged version of my protein. I designed some primers to amplify just my sequence,adding some restriction sites and introduce it in pcDNA3.
In order to do so, I added 5 bases (to allow the enzyme to cut), an EcoRI site and a kozak sequence in the Sense primer ( 17 extra bases, and 41 matched bases, 52% CG in total) and a HindIII site and 5 more bases in the Antisese oligo (11 extra bases and 43 matched bases,53% CG in total). Here my primers:

SENSE: 5´- GCAGAGCGAATTCCACCATGGCCTCACATGTGCAAGTTTTCTCCCCTCACACCCTTCAATC -3´
ANTISENSE: 5´- CCCTCAAGCTTTTATATGTAAGGGTACTGGTTGACCTTGGCGGGGCTCAGTGGG -3´

The Tm without the extra bases are about 84ºC


My protein is about 3600bp. My questions is:

Are those primers good enough to perform the pcr, and if so, how should I perform it? I was gonna do something like this:

98º 30sec
98º 10sec
55º 20sec
71º 60sec
Repeat steps 2-4 seven times

98º 10sec
75º 1min20sec
30 times

72 10 min

4ºC

Is this the best way to perform that kind of PCR??

Thanks a lot

Edited by laurequillo, 27 October 2009 - 02:00 AM.

"He must be very ignorant for he answers every question he is asked" Voltaire

"This is SPARTA!"

"I´m the goddamn batman"

#2 swanny

swanny

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 367 posts
4
Neutral

Posted 27 October 2009 - 06:41 PM

Unless you have a very fast polymerase, I don't think the extension time for the first few cycles is long enough for a 3.6 kb insert. Apart from that, the plan seems OK to me.
Heart disease kills more women than breast cancer, but heart attack symptoms differ from men's symptoms. Get to know your heart... it could save your life.

#3 laurequillo

laurequillo

    The Goddamn Batman!

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 265 posts
1
Neutral

Posted 27 October 2009 - 08:32 PM

View Postswanny, on Oct 28 2009, 03:41 AM, said:

Unless you have a very fast polymerase, I don't think the extension time for the first few cycles is long enough for a 3.6 kb insert. Apart from that, the plan seems OK to me.

Perfect, then I will change the extension time to 4 min in both cases (because in the second part of the pcr I should change it as well,right?)

Thanks a lot
"He must be very ignorant for he answers every question he is asked" Voltaire

"This is SPARTA!"

"I´m the goddamn batman"

#4 swanny

swanny

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 367 posts
4
Neutral

Posted 27 October 2009 - 08:45 PM

Have a quick look at the data sheets that came with your enzyme, and see what they recommend for extension times. No point making the reaction go for 4 hrs when you can do it in 3?
Heart disease kills more women than breast cancer, but heart attack symptoms differ from men's symptoms. Get to know your heart... it could save your life.

#5 laurequillo

laurequillo

    The Goddamn Batman!

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 265 posts
1
Neutral

Posted 27 October 2009 - 08:55 PM

View Postswanny, on Oct 28 2009, 05:45 AM, said:

Have a quick look at the data sheets that came with your enzyme, and see what they recommend for extension times. No point making the reaction go for 4 hrs when you can do it in 3?


:P  you are right! the shorter the better! :D
"He must be very ignorant for he answers every question he is asked" Voltaire

"This is SPARTA!"

"I´m the goddamn batman"

#6 HomeBrew

HomeBrew

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 927 posts
14
Good

Posted 28 October 2009 - 03:47 AM

Why so many matched bases?  I can't isolate the matched bases (could you show us that?), but assumming something like:

SENSE: 5´- GCAGA GC GAATTC CACCATGG CCTCACATGTGCAAGTTTTCTCCCCTCACACCCTTCAATC -3´
ANTISENSE: 5´- CCCTC AAGCTT TTATATGTAAGGGTACTGGTTGACCTTGGCGGGGCTCAGTGGG -3´

Why do you need such a long stretch of annealing bases?  It's just pushing your Tms way high -- can't you use a shorter stretch?

#7 laurequillo

laurequillo

    The Goddamn Batman!

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 265 posts
1
Neutral

Posted 28 October 2009 - 04:09 AM

View PostHomeBrew, on Oct 28 2009, 12:47 PM, said:

Why so many matched bases?  I can't isolate the matched bases (could you show us that?), but assumming something like:

SENSE: 5´- GCAGA GC GAATTC CACCATGG CCTCACATGTGCAAGTTTTCTCCCCTCACACCCTTCAATC -3´
ANTISENSE: 5´- CCCTC AAGCTT TTATATGTAAGGGTACTGGTTGACCTTGGCGGGGCTCAGTGGG -3´

Why do you need such a long stretch of annealing bases?  It's just pushing your Tms way high -- can't you use a shorter stretch?

The part of my primers that match the sequence are:

Sense:5´-GCCTCACATGTGCAAGTTTTCTCCCCTCACACCCTTCAATC -3´
Antisense: 5´-TATGTAAGGGTACTGGTTGACCTTGGCGGGGCTCAGTGGG-3´

I used so many bases because I had 17 and 11 "new" bases and I thought it was better that way.Maybe it is not necessary at all. I could use a shorter one, but I am not sure how short could it be without problems.

Edited by laurequillo, 28 October 2009 - 04:20 AM.

"He must be very ignorant for he answers every question he is asked" Voltaire

"This is SPARTA!"

"I´m the goddamn batman"

#8 dpo

dpo

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 67 posts
1
Neutral

Posted 28 October 2009 - 04:27 AM

why do you add that many bases to allow the enzyme to cut? for EcoRI, I normally only add one extra nucleotide and for HindIII two extra nucleotides and (so far) I haven't ran into problems that way. For the part specific to your gene of interest, I limit myself to 20-21 bp, especially if your template is a plasmid I don't expect any difficulties regarding the primers (only the length of your amplicon may prove a difficulty if you're not using a good enzyme).

Also the number of cycles seems very low imo, unless you start from an enourmous amount of template of course ...

#9 laurequillo

laurequillo

    The Goddamn Batman!

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 265 posts
1
Neutral

Posted 28 October 2009 - 04:45 AM

View Postdpo, on Oct 28 2009, 01:27 PM, said:

why do you add that many bases to allow the enzyme to cut? for EcoRI, I normally only add one extra nucleotide and for HindIII two extra nucleotides and (so far) I haven't ran into problems that way. For the part specific to your gene of interest, I limit myself to 20-21 bp, especially if your template is a plasmid I don't expect any difficulties regarding the primers (only the length of your amplicon may prove a difficulty if you're not using a good enzyme).

Also the number of cycles seems very low imo, unless you start from an enourmous amount of template of course ...

So I could add just 2 extra nucleotides for cuting and use 20 macthed bases. Perfect (is always good to know how I can improve the primers!)

Regarding the cycles. Do you think 7 cycles + 30 is not enough?

Edited by laurequillo, 28 October 2009 - 04:46 AM.

"He must be very ignorant for he answers every question he is asked" Voltaire

"This is SPARTA!"

"I´m the goddamn batman"

#10 dpo

dpo

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 67 posts
1
Neutral

Posted 28 October 2009 - 04:56 AM

View Postlaurequillo, on Oct 28 2009, 01:45 PM, said:

View Postdpo, on Oct 28 2009, 01:27 PM, said:

why do you add that many bases to allow the enzyme to cut? for EcoRI, I normally only add one extra nucleotide and for HindIII two extra nucleotides and (so far) I haven't ran into problems that way. For the part specific to your gene of interest, I limit myself to 20-21 bp, especially if your template is a plasmid I don't expect any difficulties regarding the primers (only the length of your amplicon may prove a difficulty if you're not using a good enzyme).

Also the number of cycles seems very low imo, unless you start from an enourmous amount of template of course ...

So I could add just 2 extra nucleotides for cuting and use 20 macthed bases. Perfect (is always good to know how I can improve the primers!)

Regarding the cycles. Do you think 7 cycles + 30 is not enough?

oops, my mistake, I just saw the first block of 7 cycles ... but why do you change the extension temp from 71 to 75 in the different blocks?

#11 laurequillo

laurequillo

    The Goddamn Batman!

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 265 posts
1
Neutral

Posted 28 October 2009 - 05:07 AM

View Postdpo, on Oct 28 2009, 01:56 PM, said:

View Postlaurequillo, on Oct 28 2009, 01:45 PM, said:

View Postdpo, on Oct 28 2009, 01:27 PM, said:

why do you add that many bases to allow the enzyme to cut? for EcoRI, I normally only add one extra nucleotide and for HindIII two extra nucleotides and (so far) I haven't ran into problems that way. For the part specific to your gene of interest, I limit myself to 20-21 bp, especially if your template is a plasmid I don't expect any difficulties regarding the primers (only the length of your amplicon may prove a difficulty if you're not using a good enzyme).

Also the number of cycles seems very low imo, unless you start from an enourmous amount of template of course ...

So I could add just 2 extra nucleotides for cuting and use 20 macthed bases. Perfect (is always good to know how I can improve the primers!)

Regarding the cycles. Do you think 7 cycles + 30 is not enough?

oops, my mistake, I just saw the first block of 7 cycles ... but why do you change the extension temp from 71 to 75 in the different blocks?


:rolleyes:
Actually I just wrote it and I did not pay attention. I would use the same temperature around 72ºC (the temperature here could be 70-75...I think it is not a critical point right?)

Edited by laurequillo, 28 October 2009 - 05:09 AM.

"He must be very ignorant for he answers every question he is asked" Voltaire

"This is SPARTA!"

"I´m the goddamn batman"

#12 dpo

dpo

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 67 posts
1
Neutral

Posted 28 October 2009 - 06:22 AM

View Postlaurequillo, on Oct 28 2009, 02:07 PM, said:

:P
Actually I just wrote it and I did not pay attention. I would use the same temperature around 72ºC (the temperature here could be 70-75...I think it is not a critical point right?)

best to check the datasheet of your enzyme, but I normally take 72, don't know if it would make such a difference, but if you can please the enzyme with its most comfortable temp, why change it :)

overall, I would just take the first part of your program but do this ~35 cycles:

98º 30sec

98º 10sec
55º 20sec (annealing temp depends on the sequence of your shorter primers of course)
72º 2min (Phusion enzyme needs 15-30s/kb, check with your enzyme of course)
perform this 35 cycles

72° 5min

#13 laurequillo

laurequillo

    The Goddamn Batman!

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 265 posts
1
Neutral

Posted 28 October 2009 - 06:32 AM

Perfect, Thanks! I will do the pcr in both ways and I will let you know how it goes
"He must be very ignorant for he answers every question he is asked" Voltaire

"This is SPARTA!"

"I´m the goddamn batman"

#14 laurequillo

laurequillo

    The Goddamn Batman!

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 265 posts
1
Neutral

Posted 28 October 2009 - 09:25 AM

I´ve just adjusted the primers:
Now I have 16 extra nucleotides in my sense primer (3 bases, EcorI, Kozak,ATG) plus 28 bases from my sequence. Tm 72.9, CG 53.6%
In my antisense I have 9 extra nucleotides (3 bases, HindIII) plus 31 bases from my sequence. Tm 76.7, CG 50%

Sense: 5´- AGCGAATTCCACCATGGCCTCACATGTGCAAGTTTTCTCCCCTC -3´
Antisense: 5´- CTCAAGCTTTTATATGTAAGGGTACTGGTTGACCTTGGCGGGG-3´
"He must be very ignorant for he answers every question he is asked" Voltaire

"This is SPARTA!"

"I´m the goddamn batman"

#15 HomeBrew

HomeBrew

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 927 posts
14
Good

Posted 28 October 2009 - 11:49 AM

It's difficult to be sure what stretch constitutes your matching bases (for example, I count 34 bases after your HindIII site in your reverse primer, but you say there are 31 matching bases)...

However, I think you still have way too many, and your Tm's are too high.  For example, I would do this (matching bases only):

forward primer:
GCCTCACATGTGCAAGTTTTC
21 bp, Tm 60.7 °C  

reverse primer:
TATGTAAGGGTACTGGTTGACCTTG
25 bp, Tm 60.5 °C




Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.