Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
- - - - -

Help needed about 5' UTR

  • Please log in to reply
6 replies to this topic

#1 kedar



  • Active Members
  • PipPipPipPipPip
  • 43 posts

Posted 17 October 2009 - 09:04 AM

Hi everyone,

I am confused.
I don't know whether everything infront of ATG is considered 5'UTR or not?
for specific example,



similarly, which is the 3' UTR?

any help would be appreciated.


#2 kedar



  • Active Members
  • PipPipPipPipPip
  • 43 posts

Posted 17 October 2009 - 09:58 AM

shit, already 14 views and no answer!! :(

#3 zhongmindai



  • Active Members
  • Pip
  • 19 posts

Posted 17 October 2009 - 10:14 PM

shit, already 14 views and no answer!! :(

I dislike this kind of question.
Its your homework, not ours.
The url you give us is not the gene's mRNA. 5'UTR (5' untranslated region) and 3'UTR is relative to mRNA, not genomic DNA sequences.
Zhong-Min Dai

#4 kedar



  • Active Members
  • PipPipPipPipPip
  • 43 posts

Posted 18 October 2009 - 03:11 AM

I dislike this kind of answer from a rude chinese. If somebody doesn't wanna help, they don't need to reply. Here we help each other, ok.

If somebody else is confused, here is the mRNA. http://www.ncbi.nlm.....2?report=fasta

My confusion is 'should all the sequence (till the very start) before the 1st ATG in the 1st exon be considered 5' UTR or just this part:


shit, already 14 views and no answer!! :(

I dislike this kind of question.
Its your homework, not ours.
The url you give us is not the gene's mRNA. 5'UTR (5' untranslated region) and 3'UTR is relative to mRNA, not genomic DNA sequences.

#5 zhongmindai



  • Active Members
  • Pip
  • 19 posts

Posted 18 October 2009 - 03:53 AM

I dislike this kind of answer from a rude chinese. If somebody doesn't wanna help, they don't need to reply. Here we help each other, ok.

If somebody else is confused, here is the mRNA. http://www.ncbi.nlm.....2?report=fasta

My confusion is 'should all the sequence (till the very start) before the 1st ATG in the 1st exon be considered 5' UTR or just this part:


shit, already 14 views and no answer!! :(

I dislike this kind of question.
Its your homework, not ours.
The url you give us is not the gene's mRNA. 5'UTR (5' untranslated region) and 3'UTR is relative to mRNA, not genomic DNA sequences.

"shit","rude", who used these words?
An mRNA contains 5'UTR, ORF and 3'UTR.
Zhong-Min Dai

#6 kedar



  • Active Members
  • PipPipPipPipPip
  • 43 posts

Posted 18 October 2009 - 06:42 AM

thanks , that's the spirit. I take back the rude word. :(

My answers are the same but once somebody else tells something else, it becomes a mess, you know. So, i needed to confirm.


#7 kedar



  • Active Members
  • PipPipPipPipPip
  • 43 posts

Posted 18 October 2009 - 06:49 AM

next question!

if you are asked to count the number of nt in 3' UTR, will you count AGCCCCCAATAGCCAAATAATAAAGCAGCATTGGATAATAATTTCTGA? =48 nucleotides
AAGCAGCATTGGATAATAATTTCTGAAAAAAAAAAAAAAAAAAAAAAAA? because the aaaa... i guess is poly a tail. and i guess you can add more AAAs...

according to me, it's 48..

Edited by kedar, 18 October 2009 - 06:51 AM.

Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.