Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo

Is my primer going to work for qRT-PCR?


  • Please log in to reply
6 replies to this topic

#1 Philip

Philip

    member

  • Active Members
  • Pip
  • 5 posts
0
Neutral

Posted 15 October 2009 - 09:33 PM

Hi.

It might be easy for some of you to design primers for qRT-PCR of miRNAs, but I'm new to this field.

I'm trying to perform qRT-PCR with mature miRNA sequence.

So one of my miRNAs is mir-669a-1 (aguugugugugcauguucaugu)

1. I'll add polyA tail at the 3' end of miRNA

2. perform RT with oligo dT with some unique primer attached (like the Universal Primer from companies, but i'll make my own primer)

3. perform qPCR with the primer mentioned above and miRNA specific primer

My problem is designing the miRNA specific primer.

So I think it has to be something like

AGTTGTGTGTCATGTTCA (or use the whole miRNA sequence, with U changed to T, as the primer)

But then Tm is around 50 degree C (58 if i use the whole miRNA sequence) <= based on simple equation Tm = 4(G+C)+2(A+T)

and my % of GC content is lower than 50%.

Is this how I design my primer? If yes, will this primer work? or How could I enhance result of qRT-PCR?

Please let me know how to design miRNA-specific primer, or advise me any helpful softwares for designing miRNA primers

Thank you in advance,
Philip Chung.

#2 Fizban

Fizban

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 63 posts
0
Neutral

Posted 16 October 2009 - 01:28 AM

Hi.

It might be easy for some of you to design primers for qRT-PCR of miRNAs, but I'm new to this field.

I'm trying to perform qRT-PCR with mature miRNA sequence.

So one of my miRNAs is mir-669a-1 (aguugugugugcauguucaugu)

1. I'll add polyA tail at the 3' end of miRNA

2. perform RT with oligo dT with some unique primer attached (like the Universal Primer from companies, but i'll make my own primer)

3. perform qPCR with the primer mentioned above and miRNA specific primer

My problem is designing the miRNA specific primer.

So I think it has to be something like

AGTTGTGTGTCATGTTCA (or use the whole miRNA sequence, with U changed to T, as the primer)

But then Tm is around 50 degree C (58 if i use the whole miRNA sequence) <= based on simple equation Tm = 4(G+C)+2(A+T)

and my % of GC content is lower than 50%.

Is this how I design my primer? If yes, will this primer work? or How could I enhance result of qRT-PCR?

Please let me know how to design miRNA-specific primer, or advise me any helpful softwares for designing miRNA primers

Thank you in advance,
Philip Chung.


I'm sorry i don't have any good answer for u but a single question (that is just out of curiosity): why?
why using your time and money to try to design something which is already commercially available from many different companies? consider that u'll need to design your primer and validate it to study one single mirna (what about a normalizer? that would make it 2 mIRNAs). what if u don't have interesting results? u'll have to choose another one and start from the beginning. at least u could try a commercial one and see if that particular mirna is really worth your efforts (which will be a lot of efforts if u r starting something u r new to). this is not a criticism mind well, u surely have a lot of good reasons to di what u do but i alredy saw once a person illustrating his 6 months work to design a primer to be used to stuy one miRNA. i had already done what he wanted to do, in a 2 hours work! consider that while u r working on what is commonly available and cheap other people r getting results.
good luck anyway
Fizban

#3 Philip

Philip

    member

  • Active Members
  • Pip
  • 5 posts
0
Neutral

Posted 22 October 2009 - 12:53 PM

Sorry for the late reply.

I tried to find miRNA specific primers in Invitrogen website :http://escience.invitrogen.com/ncode/index.jsp

But thing is, it doesn't have any of miRNA specific primers I'm looking for.

#4 Fizban

Fizban

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 63 posts
0
Neutral

Posted 22 October 2009 - 10:11 PM

Sorry for the late reply.

I tried to find miRNA specific primers in Invitrogen website :http://escience.invitrogen.com/ncode/index.jsp

But thing is, it doesn't have any of miRNA specific primers I'm looking for.


well u can try Applied biosystems, qiagen, exiqon and many others that sell miRNA probes. Applied has also a custom service, u give them your sequence and they give u validated primers. i think it works the same way also for other vendors.
just try, it could seve a lot of time.
Fiz :D

#5 miRNA_diabetes

miRNA_diabetes

    member

  • Active Members
  • Pip
  • 7 posts
0
Neutral

Posted 23 October 2009 - 08:15 AM

Hi Philip,

I have tried using the same approach as yours and it has worked so far for me. I just replaced the U with T and to adjust the Tm, you could try deleting some bases from the 5' end of the primer. (I am not that sure about which of the ends but i think the 3' end complementarity is more critical for extension).

I ordered them from Invitrogen.

Good luck!! ;)

#6 Philip

Philip

    member

  • Active Members
  • Pip
  • 5 posts
0
Neutral

Posted 25 October 2009 - 05:31 PM

Hi :rolleyes:

Yes, the site worked for me too. The OligoPerfect link wasn't working when I tried earlier. It works fine now.

Thank you for your reply :huh:

Philip C.

#7 v.hearne

v.hearne

    member

  • Members
  • Pip
  • 1 posts
0
Neutral

Posted 01 July 2013 - 08:30 PM

Sorry for the late reply.

I tried to find miRNA specific primers in Invitrogen website :http://escience.invitrogen.com/ncode/index.jsp

But thing is, it doesn't have any of miRNA specific primers I'm looking for.


well u can try Applied biosystems, qiagen, exiqon and many others that sell miRNA probes. Applied has also a custom service, u give them your sequence and they give u validated primers. i think it works the same way also for other vendors.
just try, it could seve a lot of time.
Fiz Posted Image


Fiz, can you give me an idea of how much Applied normally charges for the validated primers? :) Thanks! :)

-Verna




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.