Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Manual reverse primer design for bisulfite traeted DNA


  • Please log in to reply
4 replies to this topic

#1 methdetector

methdetector

    member

  • Active Members
  • Pip
  • 11 posts
0
Neutral

Posted 08 October 2009 - 11:09 AM

Hello everybody,

I am trying to design BSPs for a particular plant gene. I am using online tools to design my primers. However, there is a particular stretch in the gene for which the tool is unable to generate any primer set. This region has high CpG % as predicted by CpGplot tool and is a potential target. So, I plan to design the primers manually.

My question is, when I design reverse primers am I supposed get the reverse complement first and then change all the Cs to Ts or is it the other way around?

Any suggestion would be of great help.
Thanks in advance. :lol:

#2 gangut

gangut

    member

  • Active Members
  • Pip
  • 17 posts
0
Neutral

Posted 09 October 2009 - 03:31 AM

Hi,

not sure if that’s what you meant but to design primers better convert your sequence first and decide on which "original" dna strand you will work as after conversion they’re not complementary any longer.
So convert DNA – sense strand as I suppose - and design primers to bind this sequence. Therefore the reverse primer will already have the converted sequence and just reverse complement it before ordering.

#3 methdetector

methdetector

    member

  • Active Members
  • Pip
  • 11 posts
0
Neutral

Posted 09 October 2009 - 10:30 AM

Thank you very much. ;)

So if my sequence is something like (Just as an example)

CTGTTTCAATAGATCCCCTTACTGCTTCTTTTGAGGGGGTAGCCGGGGCCTCGCGCCTCGGCGGG
TTTTAAAGCCCCCACCTATACAAAAATAGTGGAAATAACATCAACCAACAATTTCTTCTTAGTTCTAA
CAAACTTCTTCTTCTTCTTGTTCATTTCTTTGTTATAACAACAAATCTTTGCGGAAGAGGATGCCTGCC
CTGGCTTGTTGCGTTGATGCTGCGCATGCGCCTCCCGGCTACGCTTTTCCTGCCGGGGATAGCTCT
CTTCCGTTCCCGGTGCCATGTTCGCCGGGCGTACCTCTTTCAACAACCTCCACCCATACCGCCGC
CGCCTCTGAAAATTCCTCTGCCCATTGGTCACCTTCCCTCTCTGCCGCGCTTTACAAAATCGATGG
CTGGGGTGCTCCGTATTTCTCTGTGAATTCCTCCGGCAATGTTTCCGCCCGTCCTTACGGTACGGA
CACGCTGCCTCACCAGGAGATTGATTTGCTAAAAATAGTGAAGAAAGTTTCGGATCC


Say my forward primer is

TGYTTYTTTTGAGGGGGTAGYYGGGG where Y= C or T

For designing reverse primer
TAAAAATAGTGAAGAAAGTTTCGGAT
assuming conversion (C->T) has occurred, the sequence would change to
TAAAAATAGTGAAGAAAGTTTTGGAT

Then reverse primer would be

ATCCGAAACTTTCTTCACTATTTTTA

Is this correct? Please correct me if I am wrong.

Thanks one again for you help.
Regards.

#4 gangut

gangut

    member

  • Active Members
  • Pip
  • 17 posts
0
Neutral

Posted 09 October 2009 - 01:34 PM

Hi,

exactly ;)

provided of course there are no potentially methylated Cs in your final primer - must be terribly hard when working on plants BTW, i don't envy you.. sure I know what you showed was just an example and has nothing to do with what you'll design.

I usually use snake charmer (http://insilico.ehu....ke_charmer.html) for in silico sequence conversion and then use a standard primer design program (like oligo) or my own hand to design primers - i think it works much better than all the tools designed specifically for methylation studies. Snake charmer is probably not the best choice for you, but I came across sth named kismeth, guess you already know it

good luck!

#5 gangut

gangut

    member

  • Active Members
  • Pip
  • 17 posts
0
Neutral

Posted 10 October 2009 - 10:37 AM

OMG, stupid me to write your primer should't cover a C containing region, it's probably impossible in plants. Sorry, mammals on my mind :P




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.