Jump to content


- - - - -

Small product amplification problems


4 replies to this topic

#1 Hal

    member

  • Members
  • Pip
  • 1 posts

Posted 16 September 2009 - 07:06 AM

Howdy folks, I'm a first-timer here, but I'm having trouble with some PCR products and this seemed like a good place to go.

I've been attempting to test real time PCR primers in traditional PCR conditions (no SYBR green, then run it out on a gel) in order to verify that no non-specific products are forming. However, I can't get the band of interest to appear, using either the primers I designed nor the control primers used for the housekeeping gene (GAPDH) that was used by the lab before I showed up. Both products should be 100-200bp in size.

I've messed around with the protocol a lot, but I feel like I'm missing something fundamental. I'm going to throw as much of the protocol details out there and hope that someone will notice something I'm doing wrong.

Primers of interest (based on genebank accession M26449.1)
Left - CATCATGAAAAATGGAACAAATG (23bp, TM 59, GC 30%)
Right - GAATTCCACAATCTTCTTGGATG (23bp, TM 60, GC 39%)

Reaction mixture
10x buffer (contains Mg) - 5uL
10mM dNTP - 5uL
10uM Primers, L+R - 2uL
cDNA - 100ng - ~3ug (Like I said, I've been trying quite a few different things)
1 U Taq Polymerase (NEB)
Dilute to 50uL

Thermocycler program
95 - 10 min.
(95 - 1 min.; 55 - 1 min.; 72 - 1 min.) - x30-60
72 - 5 min.

Among the changes I've attempted to make to the program, it's been changing the cycle number between 30 and 60, changing the melting temperature from 95 to 87, running a gradient on the annealing temperature from 50-60, and adjusting the time of the 95/55/72 temperatures between 10s and 1 min.

Only once have I seen a band show up, and that was with our control gene the cycle at (87-1min; 55-1min; 72-10s)x60 and almost 2ng of cDNA template in the reaction. I haven't been able to replicate that.

So, I'll ask again: Where am I going wrong? I feel like I'm missing something simple in there.

#2 sponge_nuts

    member

  • Active Members
  • Pip
  • 10 posts

Posted 16 September 2009 - 06:11 PM

Hi,

are you sure your TAQ is working? Have you tried it with any other genes? you could try a new batch of TAQ.
What about a primer concentration gradient?

#3 phage434

    Veteran

  • Moderator
  • PipPipPipPipPip
  • 1,290 posts

Posted 16 September 2009 - 06:43 PM

More than 40 cycles never adds any additional product.

Your dNTP concentration seems high, and might be affecting your effective Mg++ concentration. You might try 4x less.

What is the primer concentration you are using?

What is the volume of cDNA template you are using? Large volumes of template often contain inhibitors.

Have you considered using a premix?

#4 94mkiv

    member

  • Members
  • Pip
  • 4 posts

Posted 18 September 2009 - 12:08 PM

Do you know what your final reaction Mg++ concentration is? I've used kits that had buffer containing Mg++, but had to supplement with additional (does you kit come with a separate tube of Mg).

#5 gleb.kudr

    Enthusiast

  • Active Members
  • PipPip
  • 35 posts

Posted 18 September 2009 - 02:37 PM

Quote

95 - 10 min.
(95 - 1 min.; 55 - 1 min.; 72 - 1 min.) - x30-60
72 - 5 min.


Your polymerase greatly loses activity during this protocol (1 min on 95 is too much). Taq has a half-life of only 20 minutes at 94°C.

Try another:

95 - 5 min
(95 - 10 seс, 55- 20 seс, 72 - 20 seс) x 35-40 max
72- 5 min

It is absolutely enough time to reaction. On (95/10 55/30 and 72/30) I got even 4k product.

Edited by gleb.kudr, 18 September 2009 - 02:41 PM.






Home - About - Terms of Service - Privacy - Contact Us

©1999-2011 Protocol Online, All rights reserved.