RNAi and microRNA Method Forum

Is it posssible using shRNA vector to generate microRNA?

Tue, 07 Feb 2012 09:48:48 +0000

I would like to generate over-expression system with lentivirus. Can I use shRNA lentiviral vector? The shRNA use pol III such as U6 or H1, the CMV is better due to the pol ll. But, several paper revealed the pol lll also involved in the transcription of microRNA. Dose anyone think about that??

question: RNAi for bacteria?

Mon, 06 Feb 2012 20:20:40 +0000

Hi, I want to silence a gene in a G(+) bacteria. I want to ask will siRNA or shRNA work for prokaryotes? If not, what technique can I use?

Thanks a lot!

RNAi for bacteria

Mon, 06 Feb 2012 20:19:53 +0000

Hi, I want to silence a gene in a G(+) bacteria. I want to ask will siRNA or shRNA work for prokaryotes? If not, what technique can I use?

Thanks a lot!

LNA ISH problem

Sun, 05 Feb 2012 13:21:32 +0000

Hello,

Recently I started having problems with my LNA ISH on the rat brain. First the ISH worked fine. But all of a sudden I started having problems. Mir124 should be expressed throughout the whole brain. This is what I saw during my first LNA ISHs. However, the last couple of times there are only parts of the brain that show expression of mir124. The staining looks really spotty. I have already refreshed all buffers and tried new probe. Nothing works... Any suggestions what might be the problem?

Calculating siRNA Transfection Efficiency

Sun, 22 Jan 2012 11:38:00 +0000

Hi all,

I am going to Transfect siRNA in primary Chicken embryo fibroblast. Please suggest me how to calculate the transfection efficiency.
I ve read about using fluorescently labelled siRNAs like Alexa flour. But presently our Flow cytometer is not working. please suggest me an alternative as i am nearing my year end of my research and i have to finish my work.

THanks....
VetVinoth

miRNA extraction from cell-conditioned media?

Fri, 20 Jan 2012 13:11:13 +0000

Has anyone had any success extraction miRNA from cell-conditioned media?

Theres very little reported evidence of it out there. Some have used miRNeasy and miRVana, but yields are extremely low.

si/shRNA sequences against eGFP

Tue, 17 Jan 2012 12:57:54 +0000

Hello,

I'm looking for validated si/shRNA sequences against eGFP... Do somebody know these sequences?

Thanks!

microRNA and 3' UTR

Sun, 15 Jan 2012 18:58:58 +0000

Hello,

We would like to knock down candidate genes with second generation shRNAs using mir-30 backbone. As I read, the guide strand of a miRNAs is against the 3' UTR of the target mRNAs. Can I silence the target gene if I use sequences against coding region or the miRISC activity confine to 3' UTR?

An answer would be appreciated

SF

Designing primers for miRNA located on minus strand.

Thu, 12 Jan 2012 21:49:43 +0000

Hi,
I am very new to miRNA field. My supervisor said me to design primers for a miRNA located on minus strand of the genome. That miRNA is located in noncoding region of the genome.
I need help in designing primers. For example following is the sequence of the plus strand. what could be the primers of this sequence which could give a PCR product which i can clone in a lenti vector, and can get miRNA expression.

5' TGTGTTAAAATCTGAAGTTCTTTGTTTGTGTCTTCTGTGTCTGGAAAAGGGAGGGGGCCTTAGCTACACA
TGGCTACAGTAAAAAAGCTGACTATAAGGCTAATCATCTCAGGGGCTTTATGACCAGGTCTAAATGCTGC
TTTTATGCTTCTGGTAATAAGGCAACACATATAGACACACTACCCTGATGAAGTGGTGTCTATGATGCGC
CTTCTTTCCAGTAAGCCAAGTATTCTCGAAGGAGTTCGGGACCTTAGGTCATATCACACCCCGCTGGTAA 3'
Please help, and thanks in advance.

miRNA northern blot

Wed, 11 Jan 2012 18:10:45 +0000

Hi,
I'm trying to detect a miRNA on a northern blot without any success. My synthetic miRNA control is working so I think my blotting condition are fine so I'm not sure if I'm loosing my miRNA in the extraction process, RNA transfer or if the corsslinking isn't good enough.
Here is what I've been doing so hopefully someone call give me advice or tell me what I'm doing wrong

I am looking at miRNA16 from HEK293 cells, I have validated the the miRNA is highly expressed via qRTPCR

RNA extraction: trizol tried with and w/o EtOH wash. I also tried miRvana.
Transfer: semi-dry transfer to NytranSPC or Brightstar plus in 0.5XTBE 1hr 200mA. The gel has no RNA when I stain post transfer. Is it possible that I am over transferring to the other side/out of the membrane?
crosslinking: 1-2hr baking at 80C (I do not have a commercial crosslinker)
Probe: FAM-LNA from Exiqon and then AP anti FAM

I'd appreciate any comments or advice
Thanks

Need help with extracting miRNA from human serum using mirVana kit

Sun, 08 Jan 2012 06:04:32 +0000

HI everyone,

My colleague and I are having difficulty extracting miRNA from human serum using the Ambion mirVana miRNA isolation kit. We have used other methods with some success but the mirVana kit is really giving us some trouble. We have tried optimising the protocol but it seems we cannot get any miRNA at all. Can anyone shed any light as to where we might be going wrong?

This is what we have tried:

Blood is collected, clotted and serum removed. Serum stored at -80C until needed.
500uL serum is used for miRNA isolation. Two volumes of lysis buffer (in the ambion kit) is added to the serum. Note, this is done in two eppendorf tubes (250uL serum + 500uL lysis buffer in each tube). Incubated for 5 minutes on benchtop.
Homogenate additive added (1/10th volume - so 75uL) and incubated on ice for 10 min.
Phenol/Chloroform added and centrifuged for 10 min at RT. Interphase is compact and well defined.
Aqueous phase removed (roughly 750uL) and 1.25 volumes of 100% EtOH added.
At this stage, both tubes for each serum sample are combined into one filter cartridge.
Wash buffers are put through the filter as per protocol.
Elution: elution buffer is heated to 95deg. We have tried eluting with 100uL as per the protocol; also, eluting with 30uL and eluting with 2 x 50uL.

When read on the spectro (we don't have easy access to a nanodrop) we get consistent readings of 0 for concentration and 260/280 ratio. Our spectro is old and we dilute the elution down to 1/50 for it to be read. We have also tried diluting down to 1/25 but if we dilute less then we risk losing our extracted miRNA. We dilute in ultrapure water.

I've been reading these forums looking for some ideas and I know some of you have been successful in extracting miRNA from serum. Any help would be greatly appreciated. Thanks.

siRNA time

Wed, 04 Jan 2012 11:50:04 +0000

Hi I have been trying to get knock down for a few months now, using dharmacon smart pool....i am being told that i am missing knock down because the half life of the protein i'm looking at is 8 hours therefore the RNA half life is much shorter....The protocol suggests 24-48 for RNA analysis & i'm being told 2-3 hours, is this too short?

mir30-based shrna cloning-mismatch

Fri, 23 Dec 2011 18:16:06 +0000

Dear All,

I cloned a mir-30 based shrna on a lentiviral vector recently. I submitted for sequencing and found out that there is some mismatches on sense and antisense sequences but not mir30 context and loop sequence.

Any ideas why it is like that and how to avoid it?

Thanks

New RNAi video from Nature

Wed, 21 Dec 2011 01:23:28 +0000

checking whther there is any miRNA in introns of a specific gene.

Mon, 19 Dec 2011 11:22:14 +0000

Hi,

How is it possible to check whether any published miRNA is located in introns of a certain gene(eg. TGF ?

miRNA targeting Tfam

Thu, 15 Dec 2011 22:18:20 +0000

Does anyone know of any miRNA regulators (positive or negative) of mitochondrial transcription factor A (Tfam)?

Different transfection methods in SH-sy5y cells.

Wed, 14 Dec 2011 21:44:56 +0000

Dear All.

So I saw that "Carolin01" and "peanutnation" were discussing transfection efficiency in SH-sy5y.
Ive transfected my SH-sy5y with LPS 2000 serum free and got a renilla act. about 20, which is not alot over background but high enough to see differences in Luciferase activity.

I was thinking about transfecting with an eletroporator, does anyone a any experience doing that in SH-sy5y.
Also I have tried to use Lipofectamine LTX and FuGene which didnt work for me.

All comments are appreciated.

THANK you!!!

Sourcing a wide-variety of RNA types for protein interaction studies

Wed, 07 Dec 2011 15:49:59 +0000

Hello,

I am a structural biologist and have just solved the structure of a novel human enzyme. Very little is known about it, but I do have a small amount of evidence that it can bind to RNA.

What type of RNA is unknown. One idea I had would be to try and do a gel-shift with it, incubating with various types of RNA e.g. miRNA, snoRNA, mRNA, tRNA etc. I was wondering if anyone knew of a company or lab who worked with or produced small libraries of such molecules? I would ideally like to find a collaborator who routinely does this sort of work.

cheers

question about mRNA isolation by Triszol

Thu, 01 Dec 2011 08:57:28 +0000

Hi,
I am a newbie in mRNA isolation.
I have a question to ask and hope someone can help me out.
I was using Trisure ( which is similar to trizol) to isolate mRNA from inslin producing cell ( which is differentiated from stem cell)
Following are my steps:
Collect cell( clusters) à add Trisure à grind the clusters à adding chloroform à centrifuge at 12000rpm for 15 min at 4 ºC
Then here comes my question. I saw something weird( white stuff) are floating in the upper layer. Does anyone know what it might be and how to avoid it happened again. Does it mean that I didn’t homogenize clusters well?
Thank you in advance.

purify small RNA

Wed, 30 Nov 2011 20:58:52 +0000

Hi,
I’m isolating small RNA from total RNA using a 15% TBE-urea PAGE gel (following the small RNA Illumina protocol). I’m obtaining a high smallRNA concentration (around 200ng/ul) but the A260/280 reads are low (1.26-1.57) so I don’t know if I should go ahead with the construction of the library. Is there any method to purify my small RNA and remove the protein contamination before starting the libraries?
Any help will be greatly appreciated!