DNA Methylation and Epigenetics Forum Forum discussion on DNA methylation research http://www.protocol-online.org/forums Fri, 27 Jan 2012 18:24:16 +0000 360 In search of universal and reliable controls for methylation analyses http://www.protocol-online.org/forums/topic/24179-in-search-of-universal-and-reliable-controls-for-methylation-analyses/
I´m trying to analyze promoter regions of an mammalian organism without published methylome data by bisulfite
pcr and methylated dna enrichment. Both methods require knowledge of at least one highly methylated
and one non-methylated genomic region to use as positive and negative control, respectively. As for the
negative control, in all organisms beta actin promoter (if containing a cgi, please correct me, if wrong) should be
reliable enough, i suppose. But: Do genes exist whose promoters are methylated in most mammalian organisms (independent of
cell type) in all likelihood? The ones i know are H19 ICR and IAP (commonly used for mouse and human), but
since the genomic sequence of my organism isn`t completely annotated, i need to find other regions for my purpose.
I hope you can make a proposal, because i`m really desperate after days of searching.

My second question concerns direct sequencing of pcr products. I´ve read in other posts about the reverse
reaction being better than the forward reaction. I observe the same phenomenon. Does anybody know the
reason? And i also observe something i haven`t read about yet: The signal of all bases is equally low, except for
the Cs in CpG dinucleotides that don`t seem to be converted (=methylated). I can`t explain why their signal is
more than three times higher than the signal of adjacent bases. I´m not experienced in sequencing, but could
it result from the high C noise and be a "calculated artifact"? :)

I´m looking forward to your answers,
best regards,
Anne]]> Fri, 27 Jan 2012 18:24:16 +0000 http://www.protocol-online.org/forums/topic/24179-in-search-of-universal-and-reliable-controls-for-methylation-analyses/ Paternity DNA Testing in New York http://www.protocol-online.org/forums/topic/24173-paternity-dna-testing-in-new-york/
The Big Apple is one of the places in the country where paternity testing is often requested for. A lot of times, paternity DNA testing in New York is used to determine the father of a child or an adult with doubtful parentage, particularly when inheritances among the old, established families are involved. However, this isn't just all about family drama, too.

read the rest of the story at http://www.dnacenter.co/Paternity-DNA-Testing-NY.html]]> Fri, 27 Jan 2012 02:01:13 +0000 http://www.protocol-online.org/forums/topic/24173-paternity-dna-testing-in-new-york/ ChIP-seq P300 on mouse liver tissue http://www.protocol-online.org/forums/topic/23814-chip-seq-p300-on-mouse-liver-tissue/ Recently I run into trouble when I do ChIP-Seq against P300 in mouse liver tissue. After ChIP, the amount of DNA is really low.
I use this antibody: santa cruz SC-58
It works pretty well in human cell line, but it is bad for mouse liver tissue
Can you recommend me any P300 antibody that works in mouse?
Thanks.]]> Tue, 20 Dec 2011 01:21:26 +0000 http://www.protocol-online.org/forums/topic/23814-chip-seq-p300-on-mouse-liver-tissue/ Problems with BSP - loss of signal strength http://www.protocol-online.org/forums/topic/23811-problems-with-bsp-loss-of-signal-strength/
I am performing methylation analysis and since this is not the field my lab or myself would have any experience with, I've encountered a problem I can't seem to be able to solve by myself. So I was hoping someone might be able to help me?

I am interested in methylation patterns of promotors of two genes and have been experiencing problems with obtaining a nice sequence reading after methylation-independent PCR of bisulfite-converted DNA. Sequencer is ABI 3730 XL 96 capillary sequencer, BigDye Version 3.1, ABI KB-base caller. So far I have been using regular cycling conditions (50 degrees C annealing).

Problem: signal fades gradually, especially when using differentially methylated templates. When sequencing 100% or 0% methylated control PCR product after bisulfite treatment (therefore there are no mixed methylation sites), I get a reasonably nice reading, signal strenght stays roughly the same or fades in the same manner as, for example, with plasmid DNA. But when I try to sequence 50% methylated PCR product (mixture of 0% and 100%) or some of my samples (which also are a population of different methylation states), the signal strenght fades drastically so it is impossible to distinguish anything after around 120-150 bp.
My PCR products are 250-300 bp and have around 10 CpG sites, mostly towards the end, so it would be really difficult to sequence backwards without losing resolution in some CpG sites (even with a PCR primer with an overhang).Tm of primer for sequencing is 40/50 degrees C (I have tried two different primers for sequencing one PCR product, one a bit longer, but results were the same), primers contain only 3 nucleotides (no C's). I have also tried adjusting DNA concentration (2-10 ng/ul; company, which does sequencing for me, recommends 2-5 ng/ul for PCR fragments of given length), but without any substantial improvement.

What else can I try to get a nice read even for mixed methylation templates? From your own experience, what usually works? Adjusting Ta of sequencing to a lower temperature? 2-step cyle sequencing? Other special cycling conditions? Anything else?

In case you need additional information: I am interested in average methylation level for particular CpG sites. My source of gDNA are human cancerous and non-cancerous cell lines, treated or non-treated with DAC. gDNA was extracted using QIAamp DNA Mini Kit, bisulfite conversion was performed using EpiTect Bisulfite Kit and PCR with HotStar Taq polymerase. My positive (100% methylation) and negative controls (0% methylation) are SssI treated gDNA and PCR-amplified gDNA (before bisulfite treatment). Sequencing of individual clones is too expensive, so I have to optimize sequencing of PCR product.

I would really appreciate any advice.

Thanks,

Vesna]]> Mon, 19 Dec 2011 12:17:59 +0000 http://www.protocol-online.org/forums/topic/23811-problems-with-bsp-loss-of-signal-strength/ PLATINUM TAQ FOR MSP? http://www.protocol-online.org/forums/topic/23304-platinum-taq-for-msp/
Planning to do MSP-PCR on bisulfite treated DNA. I ordered the Platinum Taq for the MSP-PCR.
I later read in this forum that a proofreading polymerase (i.e polymerase with 3'-5' mismatch repair) can not be used in MSP.

Does anyone know if Platinum Taq would qualify for use in MSP? i did find a few references that did use it though.
but if someone recalls that this combination did'nt work for them, then are there any better suggestions for Taq used in MSP-PCR?

hope to get some advice on this matter.

Thanks for any help.]]> Wed, 02 Nov 2011 12:08:55 +0000 http://www.protocol-online.org/forums/topic/23304-platinum-taq-for-msp/ 5-azacytidine treatment http://www.protocol-online.org/forums/topic/23280-5-azacytidine-treatment/
I have been using 5-azacytidine on cancer cell lines. I have noticed strong reactivation at the protein level of my gene of interest when I apply 5-azaC. However, I have ntoiced that after sodium bisulphite sequencing the CpG island within my gene of interest is still methylated. I was wondering if there was a positve control that is frequently used to assess the efficiency of the 5-azaC treatment.

Thanks]]> Mon, 31 Oct 2011 16:12:06 +0000 http://www.protocol-online.org/forums/topic/23280-5-azacytidine-treatment/ Checking my own Methylated Control for MSP http://www.protocol-online.org/forums/topic/23172-checking-my-own-methylated-control-for-msp/ I’ve treated human DNA (from PBMCs) with M.SssI from Zymo (30ºC overnight and then re-addiction of enzyme 4 more hours) and purified according to a standard Phenol:Chlorophorm protocol.
I’m not able to sequence it yet in order to check if it’s really completely methylated so I’ve digested 200ng of converted DNA with 4 Units of HpaII and another 200ng with MspI (37ºc overnight).
I don’t know how to interpret the result of my 0.8% agarose gel. I see a range of “background” in both cases. The only difference is that MspI well has run faster than HpaII and it’s more intensive.
I expected to see a big high band in HpaII and different bands in MspI but I’m not sure if this happens with genomic DNA (I’ve seen some of you perform this with plasmids).
May 200ng be too low quantity?
I really need help because my MSPs have been stopped such a long time waiting for a control!
Thank!]]> Fri, 21 Oct 2011 11:36:51 +0000 http://www.protocol-online.org/forums/topic/23172-checking-my-own-methylated-control-for-msp/ How to define a promoter region of a gene? http://www.protocol-online.org/forums/topic/23164-how-to-define-a-promoter-region-of-a-gene/ Thu, 20 Oct 2011 22:10:52 +0000 http://www.protocol-online.org/forums/topic/23164-how-to-define-a-promoter-region-of-a-gene/ Direct sequencing - BSP http://www.protocol-online.org/forums/topic/23131-direct-sequencing-bsp/
I have been reading all the topics in the group of DNA methylation. There is an affirmation that I judge quite of intriguing:
"Sense primer usually only give worse results than reverse primer." Could someone explain me why? I am not able to see the logic on that.]]> Mon, 17 Oct 2011 23:36:56 +0000 http://www.protocol-online.org/forums/topic/23131-direct-sequencing-bsp/ methylation analysis with MS-HRM (primer design) http://www.protocol-online.org/forums/topic/23096-methylation-analysis-with-ms-hrm-primer-design/
I am studying promotor methylation. Some primers I have ordered do not work (MS-HRM with Rotor-GeneQ).
As I am reading Wojdacz and his recommendations for primer design I don't understand one thing -

he is recommending that in primer sequence there should be at least on C (the one from CpG, potentially methylated) included at 5´ end of the primer, to ensure amplification of both methylated and un-methylated sequence. Still - does this have to be a wobble base C/T (when ordering this should be Y) or not?

Example from his article: Reversal of PCR bias for improved sensitivity of the DNA methylation melting curve assay, BioTechniques, 2006: Forward primer sequence: TCGGAGGGGTGTAGATAGAGT - so no wobble base. Wouldn't this primer extend only methylated sequence?

Bit confusing for me, I would appreciate help,

thank you,

lmg]]> Fri, 14 Oct 2011 10:03:33 +0000 http://www.protocol-online.org/forums/topic/23096-methylation-analysis-with-ms-hrm-primer-design/ Methyl Binding Protein-1 (MBD1) / Immunofluorescence http://www.protocol-online.org/forums/topic/23005-methyl-binding-protein-1-mbd1-immunofluorescence/
I am currrently on anti-MBD1 staining optimisation in mouse embryonic fibroblasts for immunofluorescence.
I increased blocking serum concentration. And reduced primary antibody concentrations. But non-specific IgG is highly seen so far (with FITC). I fixed cells 4%PFA for 30min, then permeabilise PBS with tween-20 and triton-x.

I am wondering if anyone does specifically work on MBD1 staining for immunostaining...

Thanks and good luck to everyone !

Selcen]]> Thu, 06 Oct 2011 05:07:55 +0000 http://www.protocol-online.org/forums/topic/23005-methyl-binding-protein-1-mbd1-immunofluorescence/ DNA methylation of a promoter region in different age groups http://www.protocol-online.org/forums/topic/22992-dna-methylation-of-a-promoter-region-in-different-age-groups/
I am a undergrad student investigating if there are differences in DNA methylation of a gene promoter region in three distinct age group. My hypothesis is: DNA methylation will change (decrease) will increasing age. Although the best way to find out about this is to conduct a longitudinal study, however, this project is part of my Honours and so my aim was to establish a baseline into whether I could detect and measure methylation changes.

I am done with my lab work and found that there are changes in methylation patterns but they were not what I was expecting (eg. a decrease with age).

So does anyone know of any good studies that have investigated DNA methylation in the presenilin-1 gene and in at least one age group? Also, I didn't know much about epigenetics when I started and I bisulfite treated DNA extracted from whole blood (as oppose to lymphocytes and/or a specific type of WBCs). Has anyone seen significant differences in methylation between different types of WBCs? Lastly, I constructed a heat map to illustrate to my examiners that there were changes in methylation at CpG sites across my three age groups (young, middle and old). However, some of these changes included the middle age group showing the highest level of demethylation (e.g. conversion of Cs to Ts at CpG sites) compared to the old age group. Does anyone know what this means?

Thank you for you time and sorry for waffling!
Cindy]]> Wed, 05 Oct 2011 12:07:33 +0000 http://www.protocol-online.org/forums/topic/22992-dna-methylation-of-a-promoter-region-in-different-age-groups/ C/G noise in direct sequencing results http://www.protocol-online.org/forums/topic/22973-cg-noise-in-direct-sequencing-results/ When analyzing my direct sequencing results, I encounter some C background noise (when using a forward primer (G when using reverse primer)) throughout my DNA sequence. It is quite unpleasant since I am looking for the methylation status of the CpG's. This problem also persists when sequencing cloning products. Some of the genes however, didn't show this noise at all. Did anybody encounter this problem?

Thanks for any advice

Some extra information:
Primers amplify in silico just 1 DNA fragment. A test showed that 2 genes bind also on regular DNA, but 1 of these 2 does not have any C noise.
By doing the direct sequencing again, the C noise sometimes disappears. But on the other sequences that are run on the same plate, the C noise stays. I already tried to rule out contamination issues by using new primer aliquots, products, septa,....

Attached thumbnail(s)

  • Attached Image: C noise example.JPG
]]> Tue, 04 Oct 2011 14:07:09 +0000 http://www.protocol-online.org/forums/topic/22973-cg-noise-in-direct-sequencing-results/ statistical analysis or quantitative analysis method for bisulfite sequencing r http://www.protocol-online.org/forums/topic/22956-statistical-analysis-or-quantitative-analysis-method-for-bisulfite-sequencing-result/ Hollow everyone~

I am new here and have some question need help

In my study, I want to investigate the CpG island methylation pattern of interesting gene between tumor and normal cells.

So,I had collected 60 paired clinical DNA (tumor part and normal part) and performed Bisulfite PCR -->TA clone --> picked 10~12 clone for Sequencing

Now, I got all the sequencing result and aligned them by BiQ analyzer

The length of my interesting region is about 600bp, 22~26 CpG sites were located in this region.


The questions are following:

1. What quantitative methods should be used for calculated the degree of methylation level?

example 1:
if "A" pateint, tumor part contain 22 CpG sites and 10 clones were be calculated -> Totally, 22*10= 220 CpG sites act as denominator, between them,165 CpG sites(75% of 220 CpG sites) display unmethylated pattern. Than, We called this patient' tumor part in the CpG sites display hypomethylation pattern.

example 2:
if "B" patient, tumor part also contain 22 CpG sites and 10 clones were be calculated-->
7 of 10 clone display 75% unmethylated pattern (17 CpG site/22 CpG sites). han, We called this patient' tumor part in the CpG sites display hypomethylation pattern.


I just confused for which method is more suitable for analyze the bisulfite sequencing data in my study? and how to decide the parameter or cut off value? (60%, 70%, or even 90%)

Does there are any software sutable for this work?


2. Actually, My boss asked me to used another method to verify my bisulfite-sequencing results. the method had better can more easily quantify the results between normal and tumor between different patient .

Does there are anyone can give me an comment for my following experiment?


I will deeply appreciate your help


Wusian

--

kewusian@gmail.com]]> Sun, 02 Oct 2011 01:06:42 +0000 http://www.protocol-online.org/forums/topic/22956-statistical-analysis-or-quantitative-analysis-method-for-bisulfite-sequencing-result/ Anyone use Qiagen pyrosequencer? http://www.protocol-online.org/forums/topic/22925-anyone-use-qiagen-pyrosequencer/
We have a problem with the pyrosequencer. As we are looking for methylation, we are always running out of the T nucleotides and Qiagen refuse to sell us single components of the kit, we have to buy a whole new kit.

Does anyone have any solutions?

We want to test the pyrosequencer with different sequencing grade nucleotides but I'm hoping someone else will have a solution to this problem.

Many thanks!]]> Wed, 28 Sep 2011 20:54:05 +0000 http://www.protocol-online.org/forums/topic/22925-anyone-use-qiagen-pyrosequencer/ Advice on optimising bisulfite PCR sought http://www.protocol-online.org/forums/topic/22918-advice-on-optimising-bisulfite-pcr-sought/
Looking for some general advice. I am currently working on methylation analysis by both MSP-qPCR and bisulfite PCR sequencing. The former appears to be working, but I am having problems with straightforward bisulfite PCR with almost all my primer sets, specifically seeing bands around 100bp (? primer-dimers, ?primer mispriming). These vary in intensity, but are usually stronger than the target band, which is there too. I was originally using published primers but tried redesigning them with methprimer without a great deal of additional success.

The aspect I really don't understand is that the published primers originally worked fine but then developed this problem after 5-10 experiments. So I replaced everything in case I'd contaminated something without success.

Nested PCR gives very clean bands - the same set of nested primers on converted DNA (without any prior PCR) give the usual smudgy bands at 100bp. This has allowed some sequencing and to generate standards for the qPCR. However, I am still puzzled as to why the 1st PCR has this systematic error.

I have tried a variety of strategies - altering substrate DNA amount, primer, magnesium concentrations, annealing temps, extension temp, tried different machines. I am using promega hotstart Taq. The target sequences are between 300 and 500 bp (all the same area but vary with primers). My program is as follows: (these are from published literature)

95C x 10mins

95C x 1min
55C x 30s (this varies)
72C x 1min
x40

72C x 10mins

I realise that there are a number of possible strategies to try now but wondered whether anyone had any useful starting points. Would trying a different Taq be worthwhile? (I have tried the qiagen one too without success). Would addition of glycerol or DMSO add anything? Would a touchdown approach or shortening cycle times be worthwhile?

Any advice gratefully appreciated.

Al]]> Wed, 28 Sep 2011 08:56:28 +0000 http://www.protocol-online.org/forums/topic/22918-advice-on-optimising-bisulfite-pcr-sought/ Validating MeDIP by qPCR http://www.protocol-online.org/forums/topic/22756-validating-medip-by-qpcr/ I am carrying out MeDIP which may be followed by sequencing on SOLiD platform. Before taking it to SOLiD platform, as is necessary, I would be carrying out qPCR to validate and calculate the enrichment.
The question is, what should be the way to do this validation. What I know is that (similar to ChIP) we do delta delta Ct calculation. I am a little confused as to should this be between Input and MeDIP samples or between MeDIP and mock IP?
Also, is there any method we can quantify the percentage of DNA recovered after IP (except nanodrop)
A brief introduction to ACTUALLY what should we and what we can analyze after MeDIP through qPCR would be really appreciated]]> Sun, 11 Sep 2011 20:28:25 +0000 http://www.protocol-online.org/forums/topic/22756-validating-medip-by-qpcr/ DNA methylation and alternative splicing http://www.protocol-online.org/forums/topic/22735-dna-methylation-and-alternative-splicing/
Does anyone has some experience with DNA methylation and alternative splicing?

In my current data we see that methylation of one exon (exon 2) correlates with the expression of different isoforms of one gene. It has been described that the another TSS is located in exon 3...

I didn't found so many information about it in the literature so I'm wondering if somebody else has experience with this.

Thank you in advance!]]> Thu, 08 Sep 2011 18:53:05 +0000 http://www.protocol-online.org/forums/topic/22735-dna-methylation-and-alternative-splicing/ Biotinylation of methylated bases http://www.protocol-online.org/forums/topic/22717-biotinylation-of-methylated-bases/
Does anyone know of a protocol for the biotinylation of methylated bases?

Cheers]]> Wed, 07 Sep 2011 09:07:27 +0000 http://www.protocol-online.org/forums/topic/22717-biotinylation-of-methylated-bases/ checking msp primers http://www.protocol-online.org/forums/topic/22648-checking-msp-primers/
I designed msp primers using Methprimer. I want to know if my primers are good enough to do a job.

Please help!

Attached File(s)

]]> Tue, 30 Aug 2011 17:15:43 +0000 http://www.protocol-online.org/forums/topic/22648-checking-msp-primers/