HI,
I was wondering if anyone has answers as to why my PCR product is one big streak from well to end. Somtimes a band shows up where expected but in the background (or foreground) is the large, sometimes bright streak. We've been having this problem for a while. Sometimes it's not there but nothing different was done with extraction or PCR parameters. We use optimal thermocycling conditions for our primers, so we're pretty sure it's not in the PCR reaction.
We've also encountered bright bands in wells followed by those streaks of some samples. Any suggestions would be greatly appreciated!

Thank you in advance.
kudna

Hi Kudna,

I have had this problem before in the lab. But we realised that it was because People in the lab were too lazy to change the TAE buffer that was used to run the gel.

Hope this helps!

Kiwi

Thank you for the reply Kiwi.

We change our TAE every 5 runs. I'm one of the few in the lab so I have good tabs on how often it's changed.
We were thinking it may be carry-over contamination. How would that produce such intense streaks?

Kudna

The only thing I can think of to produce long smears is chromosomal DNA from bacteria (what I'm used to working with). I don't know what your template is but, if there is too much of it, that will show up on a gel. I had a no-result PCR problem for the longest time so I got used to tweaking all the variables. My other suggestion would be to get new stocks of your individual components in case one somehow got contaminated. I am also assuming you follow storage reccommendations for the components and use sterile equipment, tubes, and whatever. Let us know what happens.

The template is mycorrhizal DNA. We deal with tiny root tips with a tiny amount of fungal DNA on it so we know that too much DNA is not the issue. We often encounter the problem of no bands which I've heard is common with this type of tissue but the smears seem to be interferring with amplification it seems because the occurence of bands is even less now.
I'm in the process of receiving new PCR components, have made up fresh solutions for extractions and use sterile tips, tubes etc everytime (always have) so we will have to be patient. Thanks. Will keep you posted.

Check if you have the same buffer in the made agarose gel as you use when running the gel...

/Nina

yes, of course! I do have the same buffer in the gel as in the gel box.
Thanks.
Kudna

Your problem sounds like non-specific amplification to me, have you tried raising the annealing temperature and/or lowering the primer concentration in your PCR. Another trick would be to lower the DNA concentration in the reaction, sometimes too much DNA can cause these sorts of effects.

I agree with Bob1, but what is the theory behind smearing? Why do we get amplification of fragments of evenly distributed size which show up as a smear? Sometimes you just could not find a clue.

What concentration of Mg2+ are you using? Too much Mg2+ can cause smearing and decrease the specificity of the annealing. The optimal range is 1mM-2.5mM

Hope this is helpful

Ihab

p.s. check out this PCR troubleshooting site
http://info.med.yale.edu/genetics/ward/tavi/PCR.html

Thank you for your replies. It turns out the carry-over contamination may infact have been the problem. After making up fresh solutions and ordering new primers, taq, dNTPS's etc, using a new set of pipets, and setting up post-PCR in a different lab (don't know which of these or how many of these solved the problem) the streaking has disappeared and the bands are bright.
The Mg2+ concentration I'm using is 1.6mM which I haven't changed so I don't think that affected it but thank you for the suggestion, and the thank you for the troubleshooting site recommendations Ihab. Very helpful.



Kudna

Hi Kudna,

it seems you solved the problem, however just an additional comment:

Occationally you can run into PCR primer/amplicon designs where the amplicon can in some way prime itself, to generate concatanated products which will accumulate in number and size as the PCR cycles, hence the smear. This can depend on the exact specificity of teh reaction and hence seem to reappear quite ramdomly, especially if the priming is just borderline.

What are your sequences? Try to check if there is an internal repeat, which would allow the PCR product to act as a primer on itself.

Søren

Søren M. Echwald, MSc., Ph.D.
-----------------------------
Exiqon A/S
Bygstubben 9
DK-2950 Vedbaek
Denmark

www.ProbeLibrary.com
One Real-time PCR kit, which covers 38.565 genes

I think "smesme" has given some theory behind smearing, which makes sense. I like it.

Hi there,

I think i may be having a similar problem - my pcr has randomly started appearing as smears. If this was due to an internal repeat in the amplicon is there anything you could do to prevent it?

Thanks

M

Dear Maza...

I think, you should redesign your primer. It should specific that amplify the target gene only. otherway, it will produce primer dimer. However, before do taht, try to increase the annealing Tm.

the PCR trouble shooting link sent to kudna by ihab is great
thanks ihab
and for kudna im happy u solved ur problem, i had a simillar one and turned out to be that the TAE buffer we are REUSING has exhusted it self
things got better afterpreparing fresh solutions

It seems that this topic has been answered to death, but I had a thought that no one else brought up, and it may help someone in the future?

Oligos will degrade over time, even when properly resuspended in nuclease free water or buffer and aliquoted and stored at -80...eventually they will degrade and this could cause non-specific priming. Based on my personal experiences in the lab, I would consider this problem first if I began to see smeary gels, particularly if I were careful about good technique everywhere, especially if the problem seems to get worse over time.

I had a similar experience once and spent a few months going through every detail of my protocol...remade and reordered my other solutions 8 trillion times and was very frustrated...and it just turned out to be oligo degradation.

hi
do mean by oligonucleotides the primer stock prepared ???
and if that is the case how can u maaake sure that ur primer stock is dead???????

Hi,
please can anybody help me

for bad lucky, my gen (the sequence ) until now not identify from fungi, but identified from higher plant only. so, i used this sequence from higher plant to design from it my primer ( gen in fungi is the same function and nam as from higher plant) so i used it.

**1- in the first i designed from conserved reigon but formed bad result and primer- dimer ( in sample brode band, in control thin band but the both at same size) may be primer-dimer,
**2- design as program by take part of sequence similar in all speacies of plant but result not good also, same band in control and sample as same size but when increase annealing disappeared in both although, Delta G -4 only.

** 3- then designed another primer as sequence of primer used in higher plant this is:
forwared: 5'- AACATAGATGGTGTAGAGGGT -3'

reverse : 5'- GATAGTTTCTATCGGCTGCAT -3'

HETERO-DIMER ANALYSIS

Primary Sequence

5'- AACATAGATGGTGTAGAGGGT -3'

Secondary Sequence

5'- GATAGTTTCTATCGGCTGCAT -3'

Maximum Delta G -37.96 kcal/mole

Delta G
-5.61 kcal/mole

Base Pairs
5

from this data i can said the % of formation of primer -dimer was very less.

**in higher plant must was the product size 420 Bp not (100-150 Bp) only. in the first : at RT-PCR (RNA) formed same band at same size in control but when increased the anneling the band disappeared from control but Continued to found in sample and i send my picture to see it. this is change in interpretation what is happening?

I used PCR reaction (from DNA) to confirm the result because i am afraid from this band may be primer- dimer only not original band on the basis of appearence with all primer used but with chang the case from (" appeared" & "disappeared") with increase annealing.

i found same band at same size in RCR- reaction in control & sample but this at low annealing (55 o C ) temperature. i will increase the annealing (60 oC) as i used in RT-PCR may be disappeared from control, i hope. so, i can't know what this is means? rhight sequence or primer- dimer only.

sorry,sorry for elongation
saly4ever@hotmail.com

I had the same problem a while back. I struggled with it for about 1.5 years, trying to work things out but I got nowhere. After about 6 months of waiting around I tried again and all of a sudden everything worked and I got bright bands. I ordered everything new, but used the same primers and templates.

hi,

this can often be caused by excessive DNA template and primer. check your concentrations.

J

Hi!

We are also working with fungi (from Lichen). We now use the quiagen Miniplant kit to purify the samples which really gives nice genomic DNA. I then perform PCR with PCR-beads from GE healthcare (ready to go beads). There you only add Primer, water and 2,5µl DNA (1:20 dil.). They really work perfectly. We had a lot of trouble with smear and everything. There are always these stupid stuff things left in the fungi which also trouble PCR. Try our method it really works perfectly!!

Have fun!!