![]() ![]() |
Nov 4 2009, 06:36 PM
Post
#1
|
|
|
member ![]() Group: Active Members Posts: 9 Joined: 29-September 09 Member No.: 12805 |
I am going to send my recombinant plasmid to a sequencing facility. I used pGEM Teasy vector which contains a T7 promoter. The form that I am filling up gives 2 options for T7 as sequencing primer namely T7 (AATACGACTCACTATAG) and T7 Promoter (TAATACGACTCACTATAGGG). These primers target the same site in the plasmid but vary a bit in length. Please help me choose which should I use.
Thanks! |
|
|
|
Nov 4 2009, 10:25 PM
Post
#2
|
|
|
I am going to send my recombinant plasmid to a sequencing facility. I used pGEM Teasy vector which contains a T7 promoter. The form that I am filling up gives 2 options for T7 as sequencing primer namely T7 (AATACGACTCACTATAG) and T7 Promoter (TAATACGACTCACTATAGGG). These primers target the same site in the plasmid but vary a bit in length. Please help me choose which should I use. Thanks! The longer the complementary sequence, the lower the chance you got the contaminated result, I think. So the longer sequence would be my choice |
|
|
|
|
Nov 4 2009, 10:50 PM
Post
#3
|
|
|
Veteran ![]() ![]() ![]() ![]() ![]() Group: Active Members Posts: 213 Joined: 26-January 09 Member No.: 6449 |
I would choose T7 promoter as well.
|
|
|
|
Nov 7 2009, 12:13 AM
Post
#4
|
|
|
member ![]() Group: Active Members Posts: 9 Joined: 29-September 09 Member No.: 12805 |
I am going to send my recombinant plasmid to a sequencing facility. I used pGEM Teasy vector which contains a T7 promoter. The form that I am filling up gives 2 options for T7 as sequencing primer namely T7 (AATACGACTCACTATAG) and T7 Promoter (TAATACGACTCACTATAGGG). These primers target the same site in the plasmid but vary a bit in length. Please help me choose which should I use. Thanks! The longer the complementary sequence, the lower the chance you got the contaminated result, I think. So the longer sequence would be my choice Thanks for your help! |
|
|
|
Nov 7 2009, 12:14 AM
Post
#5
|
|
|
member ![]() Group: Active Members Posts: 9 Joined: 29-September 09 Member No.: 12805 |
|
|
|
|
![]() ![]() |
|
Lo-Fi Version | Time is now: 21 Nov 2009 - 12:11 PM |
| IP.Board Skin Developed By Creative Networks | ||
|
Home
- About
- Terms of Service
- Privacy
- Feedback
©1999-2009 Protocol Online, All rights reserved. |