Welcome Guest ( Log In | Register )

 
Reply to this topicStart new topic
> sequencing primer: T7 or T7promoter?
kristian
post Nov 4 2009, 06:36 PM
Post #1


member
*

Group: Active Members
Posts: 9
Joined: 29-September 09
Member No.: 12805



I am going to send my recombinant plasmid to a sequencing facility. I used pGEM Teasy vector which contains a T7 promoter. The form that I am filling up gives 2 options for T7 as sequencing primer namely T7 (AATACGACTCACTATAG) and T7 Promoter (TAATACGACTCACTATAGGG). These primers target the same site in the plasmid but vary a bit in length. Please help me choose which should I use.
Thanks!
Go to the top of the page
 
+Quote Post
Quasimondo
post Nov 4 2009, 10:25 PM
Post #2


E. coli farmer
**

Group: Active Members
Posts: 48
Joined: 27-January 09
From: KAIST, Korea
Member No.: 6685



QUOTE (kristian @ Nov 5 2009, 11:36 AM) *
I am going to send my recombinant plasmid to a sequencing facility. I used pGEM Teasy vector which contains a T7 promoter. The form that I am filling up gives 2 options for T7 as sequencing primer namely T7 (AATACGACTCACTATAG) and T7 Promoter (TAATACGACTCACTATAGGG). These primers target the same site in the plasmid but vary a bit in length. Please help me choose which should I use.
Thanks!

The longer the complementary sequence, the lower the chance you got the contaminated result, I think. So the longer sequence would be my choice
Go to the top of the page
 
+Quote Post
jiajia1987
post Nov 4 2009, 10:50 PM
Post #3


Veteran
*****

Group: Active Members
Posts: 213
Joined: 26-January 09
Member No.: 6449



I would choose T7 promoter as well.
Go to the top of the page
 
+Quote Post
kristian
post Nov 7 2009, 12:13 AM
Post #4


member
*

Group: Active Members
Posts: 9
Joined: 29-September 09
Member No.: 12805



QUOTE (Quasimondo @ Nov 5 2009, 02:25 PM) *
QUOTE (kristian @ Nov 5 2009, 11:36 AM) *
I am going to send my recombinant plasmid to a sequencing facility. I used pGEM Teasy vector which contains a T7 promoter. The form that I am filling up gives 2 options for T7 as sequencing primer namely T7 (AATACGACTCACTATAG) and T7 Promoter (TAATACGACTCACTATAGGG). These primers target the same site in the plasmid but vary a bit in length. Please help me choose which should I use.
Thanks!

The longer the complementary sequence, the lower the chance you got the contaminated result, I think. So the longer sequence would be my choice

Thanks for your help! smile.gif
Go to the top of the page
 
+Quote Post
kristian
post Nov 7 2009, 12:14 AM
Post #5


member
*

Group: Active Members
Posts: 9
Joined: 29-September 09
Member No.: 12805



QUOTE (jiajia1987 @ Nov 5 2009, 02:50 PM) *
I would choose T7 promoter as well.

Thanks! smile.gif
Go to the top of the page
 
+Quote Post

Reply to this topicStart new topic

 



RSS Lo-Fi Version Time is now: 21 Nov 2009 - 12:11 PM
IP.Board Skin Developed By Creative Networks
Home - About - Terms of Service - Privacy - Feedback

©1999-2009 Protocol Online, All rights reserved.