sequencing primer: T7 or T7promoter? (View forum version)



kristian

Posted 04 November 2009 - 06:36 PM

I am going to send my recombinant plasmid to a sequencing facility. I used pGEM Teasy vector which contains a T7 promoter. The form that I am filling up gives 2 options for T7 as sequencing primer namely T7 (AATACGACTCACTATAG) and T7 Promoter (TAATACGACTCACTATAGGG). These primers target the same site in the plasmid but vary a bit in length. Please help me choose which should I use.
Thanks!

Qundo12

Posted 04 November 2009 - 10:25 PM

I am going to send my recombinant plasmid to a sequencing facility. I used pGEM Teasy vector which contains a T7 promoter. The form that I am filling up gives 2 options for T7 as sequencing primer namely T7 (AATACGACTCACTATAG) and T7 Promoter (TAATACGACTCACTATAGGG). These primers target the same site in the plasmid but vary a bit in length. Please help me choose which should I use.
Thanks!

The longer the complementary sequence, the lower the chance you got the contaminated result, I think. So the longer sequence would be my choice

jiajia1987

Posted 04 November 2009 - 10:50 PM

I would choose T7 promoter as well.

kristian

Posted 07 November 2009 - 12:13 AM

I am going to send my recombinant plasmid to a sequencing facility. I used pGEM Teasy vector which contains a T7 promoter. The form that I am filling up gives 2 options for T7 as sequencing primer namely T7 (AATACGACTCACTATAG) and T7 Promoter (TAATACGACTCACTATAGGG). These primers target the same site in the plasmid but vary a bit in length. Please help me choose which should I use.
Thanks!

The longer the complementary sequence, the lower the chance you got the contaminated result, I think. So the longer sequence would be my choice

Thanks for your help! :)

kristian

Posted 07 November 2009 - 12:14 AM

I would choose T7 promoter as well.

Thanks! :)