Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!

Functional Screens's Content

There have been 41 items by Functional Screens (Search limited from 17-July 18)



Sort by                Order  

#93366 Lentivirus toxicity

Posted by Functional Screens on 28 November 2010 - 01:16 PM in siRNA, microRNA and RNAi

DO NOT use .22um filter, please use .45um filter before ultracentrifugation.



#93365 lentivirus

Posted by Functional Screens on 28 November 2010 - 01:13 PM in siRNA, microRNA and RNAi

Of course you can do that, but why not generate the lentiviruses separately, titer them and then mix them with the equal titer?



#93364 Same backbone different GFP intensity

Posted by Functional Screens on 28 November 2010 - 01:00 PM in siRNA, microRNA and RNAi

The miRNA precursor sequence cloned on the pGIPZ vector is one the same "exon" (or transcript). So, when the pre-miRNA gets processed, the GFP mRNA will be degraded. More of pre-miRNA gets processed, less GFP will be expressed.
reference link:
http://www.protocol-...n-mirna-vector/



#88658 How to overexpress miRs

Posted by Functional Screens on 03 October 2010 - 03:29 PM in siRNA, microRNA and RNAi

There are several companies making miRNA expression vectors
Open Biosystem, System Biosciences, GeneCopoeia, and Biosettia make lentiviral miRNA expression vector
Oirgene makes plasmid-based miRNA expression vector.
System Biosciences and Origene use dual promoters to express microRNA and selection marker, the problem is you might not know whether the miRNA is expressing when you selection marker is expressed from the other promoter. GeneCopoeia uses H1 promoter for miRNA expression and I guess they only express the pre-miRNA. I wonder the processibility of mature miRNA in the absence of flanking sequences in its precusor. Open Biosystem use one promoter and miRNA precursor is cloned in the "exon". I don't understand how the RFP and puro-resistant gene can be expressed while the same mRNA is processed by Drosha. Biosettia's miRNA expression vector has miRNA precursor cloned in the EF1a intron and RFP-puro expressed from the same promoter. I think it's a smart way to overexpress miRNA.



#88655 siRNA to shRNA...trouble!

Posted by Functional Screens on 03 October 2010 - 02:39 PM in siRNA, microRNA and RNAi

The successful rate of converting siRNA to shRNA is about 70%.
A lot of siRNA design was not compatible with Zamore rules, so I will suggest you to go to different online shRNA designer to see whether you can get one close to your siRNA sequence.



#85045 Retrovirus production

Posted by Functional Screens on 28 August 2010 - 09:58 AM in siRNA, microRNA and RNAi

check Takara or NoLan lab
http://catalog.takar...itid=U100005745
http://www.stanford...._packlines.html

However, I will recommend using packaging cell line for retroviral production.



#85044 miRNA spike-in control

Posted by Functional Screens on 28 August 2010 - 09:54 AM in siRNA, microRNA and RNAi

For human samples, we used U47 small RNA as endogenous control.



#85043 siRNA sequence can be used as shRNA?

Posted by Functional Screens on 28 August 2010 - 09:43 AM in siRNA, microRNA and RNAi

The successful rate of si/sh-RNA conversion is not 100%.
U6 promoter prefers G as start and H1 promoter prefers A or G (C or T should be fine). Your siRNA sequence starts from C, so you might want to use H1 promoter.



#83063 shRNAs work in vitro, not in vivo

Posted by Functional Screens on 10 August 2010 - 10:36 PM in siRNA, microRNA and RNAi

I will definitely pick the shRNA always gave more than 70% knockdown in your 1:1 or 1:0.2 reporter assay. You might want to introduce your luciferase reporter in vivo for confirmation.



#82731 shRNAs work in vitro, not in vivo

Posted by Functional Screens on 07 August 2010 - 12:24 PM in siRNA, microRNA and RNAi

1. One of your target gene has feedback regulation
2. The primer sets you used for genome-typing are not good for RT-qPCR or qRT-PCR especially when you have genomic DNA contamination.
3. Dosage issue or shRNA potency; the same dosage works for your colleague because his target gene can be silenced in a lower concentration of shRNA. You might want to screen more potent shRNA by playing around the ratio of shRNA vector/luc-target vector (e.g. 1:1 or 1:5). Then use the shRNA for your in vivo experiments.



#82571 shRNA

Posted by Functional Screens on 05 August 2010 - 02:53 PM in siRNA, microRNA and RNAi

May be the following problems:
1. PRC primer set on the same exon
2. Genomic DNA contamination or gene homologue
3. Feedback regulation / compensation
4. cell culture condition (better change or split cells before assay)



#82569 Differences between lentiviral packaging kits

Posted by Functional Screens on 05 August 2010 - 02:08 PM in siRNA, microRNA and RNAi

I've found a possible option on genecopeia but my supervisor pointed out that he has previously used plasmids in which the gfp expression is driven by U6 promoter whereas the plasmid that I found drives gfp expression under the cmv promoter. Because of this he said that our current packaging system may not work with this new plasmid.

I have not heard GFP expressed by U6 (pol III) promoter.
Your packaging system has nothing to do with U6 promoter and GFP expression.


My question is what part of the packaging system differs between the various companies and and as result determines whether a given plasmid will work with a particular packaging system?

Depending on the lentiviral vectors, I found the following web site showing the differences between two general packaging systems.
http://biosettia.com...l-packaging-mix

I have used their lentiviral shRNA vector, The cloning strategy is very very clever and efficient.




#76344 Problem in shRNA Annelaing ( Help Required )

Posted by Functional Screens on 21 June 2010 - 10:33 AM in siRNA, microRNA and RNAi

The (top and bottom) single stranded oligos were "self-annealed", just like shRNA (but it's shDNA).



#75746 Lentivirus production with LNCX vector

Posted by Functional Screens on 16 June 2010 - 10:55 PM in siRNA, microRNA and RNAi

Nope, lentiviral packaging vectors for lentiviral vectors, retroviral packaging cell lines for retroviral vectors.



#75509 Lentivirus production with LNCX vector

Posted by Functional Screens on 15 June 2010 - 02:16 PM in siRNA, microRNA and RNAi

The LNCX vector (Clontech) is a retroviral vector, not a lentiviral vector, so you cannot use psPAX2 and VSVG for package. You need to use retroviral package cell lines such as Ampho293, LNX A.



#68518 Designing siRNA from Sequence provided by Qiagen

Posted by Functional Screens on 28 April 2010 - 06:56 AM in siRNA, microRNA and RNAi

I think you better confirm whether your siRNA sequence CCGAGCCACATCGCTCAGACA is identical to your target mRNA sequence. If so, you might want to take the first 19-nt (the last 2 nt CA will be the overhang). You can replace CA with dTdT, but you can also just use CA. It does not matter that much. Your antisense strand will be UGUGAGCGAUGUGGCUCGGdTdT. The dTdT can be replaced with the nucleotides complementary to the target mRNA as well.



#68162 Dicer knockdown

Posted by Functional Screens on 26 April 2010 - 07:01 AM in siRNA, microRNA and RNAi

grow cells under drug selection for a week, then it's up to you. For example, you can have antibiotics all the time, or you can do one time selection every month to ensure all cells still have the constructs.



#68024 How to retrieve precursor miRNA sequence with extra bases for cloning

Posted by Functional Screens on 24 April 2010 - 07:02 AM in siRNA, microRNA and RNAi

You can also retrieve genomic sequence from UCSC database:

choose "blat"
copy miRNA precursor sequence obtained from mirbase.org to blat genome.
it gives you 100bp flanking sequences on both 5' and 3' ends.



#67784 Dicer knockdown

Posted by Functional Screens on 22 April 2010 - 06:25 AM in siRNA, microRNA and RNAi

[size="2"]you said it's better to linearize the plasmid before transfection, If I understood properly, you mean cutting the plasmid with an enzyme, opening it then transfection. :D

Non-homologous end-joining will join many copies of linearized vector and then homologous recombination will integrate multiple copies of your vector (the drug selection gene and shRNA expression cassette) into host genome. For example, a (unique) ScaI site in the Amp gene can be used to linearize the vector. Also, you might need to do longer selection to ensure the recombination/integration.



#67661 Dicer knockdown

Posted by Functional Screens on 21 April 2010 - 09:10 AM in siRNA, microRNA and RNAi

I tried to knockdown Dicer with siRNA, vector-shRNA, retroviral-shRNA in 2002. The best knockdown I can get is around 60%. Please note shRNA requires Dicer to process to siRNA, therefore you might not be able to get >70% knockdown.
It may be lethal especially in embryonic cells.
In your case, transfection efficiency matters. Linerization of vector is highly recommended. Longer selection time may be needed for vector integration.



#67425 miRNA clusters

Posted by Functional Screens on 20 April 2010 - 06:59 AM in siRNA, microRNA and RNAi

Although 19a and 19b may target the same gene(s), you might want to express 19a, 19b and 19a+19b to see if there's anything different. Also, you might want to make sure the level of expression are the same.



#66710 short 3'UTR

Posted by Functional Screens on 14 April 2010 - 06:59 PM in siRNA, microRNA and RNAi

It has been shown miRNAs do not only target 3'UTR, in some cases they target ORF or promoter region. In certain conditions, miRNA activates gene expression instead of suppression.
By the way, is there any possibility that any splice variants have longer 3'UTR?



#66679 CMV-delta R8.2 and pCMV-delta R8.2

Posted by Functional Screens on 14 April 2010 - 02:12 PM in siRNA, microRNA and RNAi

Second generation systems will also package third generation lentiviral vectors (in addition to second generation vectors).
This one should express TAT which is required for all second generation vectors and dispensible for third-gen

True, in my experiences using the 2nd generation packaging system seems not as good as using the 3rd generation system for 3rd generation lenti vector in virus production.



#66678 How to do stable knock-down by shRNA advices for beginner

Posted by Functional Screens on 14 April 2010 - 02:03 PM in siRNA, microRNA and RNAi

1. The siRNA to shRNA converting (successful) rate may not be 100%, you might want to use some designers to double check.

2. For non-viral vector, I have used pSUPER (OligoEngine), BLOCK-iT U6 and H1TO (Invitrogen), and pRNAi (Biosettia). Invitrogen and Biosettia RNAi vectors are linerized and OligoEngine's pSUPER is sold as circular plasmid. The linearized vectors give you much lower background (i.e. inoculate 2-3 colonies and you might get them all right). Personally I favor Biosettia's vector since only one DNA oligo is required to make shRNA clone, it's amazing and really high efficiency. I don't use next-door's free RNAi vectors any more because the oligo money I saved from using Biosettia's vector just like I get it for free. So, I don't bother to digest and gel-purify other RNAi vectors since then.

Below is the links for protocols:
OligoEngine
http://www.oligoengi...ER_protocol.pdf
Invitrogen
http://tools.invitro...yvector_man.pdf
Biosettia
http://biosettia.com...rnai-manual.pdf

3. The shRNA viral vector especially lentiviral shRNA vector overcomes the transfection issue since quite a few cells are hardly transfected. But the lentiviral packaging is a key, you better good on packaging. A lot of people use pLKO.1 since it's free but I am quite loyal to one oligo shRNA method to save time.

4. Linerize your non-viral shRNA vector before transfection, the non-homolog end joining and homologous recombination should give you multiple copy integration. check the protocols listed above.

Good Luck.



#66095 lentiviral overexpression of miRNAs

Posted by Functional Screens on 09 April 2010 - 06:46 AM in siRNA, microRNA and RNAi

Yes, you're right.
Please note, for HIV/lenti infection: @12hr late-RT reaction reaches the peak; @24hr 2-LTR circle reaches the peak; @24hr integration reaches the peak. So, you are detecting most of late-RT products plus some LTR-circle and integrated cDNA. However, it gives you an idea how many copies of lentiviral genome get into your model cells.
Please wash your cells before extraction to remove plasmids carried over from your lentiviral transduction.
Good luck.




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.